EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr1:24610726-24610745]
Chromosome characteristics of REST[chr1:24610726-24610745]
Back to top
Enhancers possibly regulated by REST[chr1:24610726-24610745]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 24599645 24630859 enh11619
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Kidney Epithelial (MCF-7) Skin (Keratinocyte) Stomach Ovary Bone (Osteoblast) Lung (A549) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Prostate (RWPE1) Muscle (A673)
SNP sites on REST[chr1:24610726-24610745]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 24610732 rs150108675 CGGCTGAGTCCTGGGTGACTCA C 164449
chr1 24610732 rs57499489 CGGCTGAGTCCTGGGTGACTCA C 164450
Genes possibly regulated by REST[chr1:24610726-24610745]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr1:24610726-24610745]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results