EnhancerDB
  1. Home
  2. TFBS
  3. NR2C2[chr1:43999690-43999705]
Chromosome characteristics of NR2C2[chr1:43999690-43999705]
Back to top
Enhancers possibly regulated by NR2C2[chr1:43999690-43999705]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 43989845 44027077 enh11814
Astrocyte Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on NR2C2[chr1:43999690-43999705]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 43999692 rs192609056 C T 273372
chr1 43999693 rs76954529 G A,C 273373
chr1 43999703 rs563124987 TCGGAGGTCAGGGTGAGGTGAGTC T 273374
chr1 43999703 rs71854306 TCGGAGGTCAGGGTGAGGTGAGTC T 273375
Genes possibly regulated by NR2C2[chr1:43999690-43999705]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR2C2[chr1:43999690-43999705]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results