EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr11:12749022-12749032]
Chromosome characteristics of SP1[chr11:12749022-12749032]
Back to top
Enhancers possibly regulated by SP1[chr11:12749022-12749032]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12737605 12756915 enh13786
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on SP1[chr11:12749022-12749032]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12749023 rs575258801 CCCATCCCACAGTGGGGACTGAGGATAAAGTCA C 1859426
Genes possibly regulated by SP1[chr11:12749022-12749032]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr11:12749022-12749032]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results