Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113064361 rs574935841 CAAAAAAAGAAAGGAAGAAAAAG C 2271632
chr11 113064375 rs541465463 A G 2271633

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results