EnhancerDB
  1. Home
  2. TFBS
  3. NR2F1[chr11:123038217-123038230]
Chromosome characteristics of NR2F1[chr11:123038217-123038230]
Back to top
Enhancers possibly regulated by NR2F1[chr11:123038217-123038230]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 123027364 123061967 enh14348
Brain (SK-N-MC) Astrocyte Pancreas Uterus Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Lung (A549) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on NR2F1[chr11:123038217-123038230]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 123038227 rs567773711 TCGTGATCCGCCTGCCTTGGCCTCCCAAA T 2329288
chr11 123038229 rs565781443 G A 2329289
Genes possibly regulated by NR2F1[chr11:123038217-123038230]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR2F1[chr11:123038217-123038230]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results