EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr16:29166602-29166622]
Chromosome characteristics of RREB1[chr16:29166602-29166622]
Back to top
Enhancers possibly regulated by RREB1[chr16:29166602-29166622]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29150646 29173335 enh16623
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Ovary Esophagus Astrocyte Blood (T-cell) Lung (A549) Stomach Placenta Uterus Lung (PC-9) Breast Muscle (Myotube) Neural Stem Cells (H9) Thymus Heart
chr16 29166546 29166864 vista22320
VISTA
SNP sites on RREB1[chr16:29166602-29166622]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29166621 rs537570515 GGCCGGGGACACGTGAGAGCTGGGGTCATGTGAGA G 4402061
Genes possibly regulated by RREB1[chr16:29166602-29166622]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr16:29166602-29166622]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results