Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 815865 843495 enh32037

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 828128 rs557107044 GGCAGGAAGTACAGGTACACAGA G 4687179
chr17 828131 rs533901223 A T 4687180

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results