EnhancerDB
  1. Home
  2. TFBS
  3. ESR1[chr17:2773298-2773316]
Chromosome characteristics of ESR1[chr17:2773298-2773316]
Back to top
Enhancers possibly regulated by ESR1[chr17:2773298-2773316]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2744850 2808324 enh4213
Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Neural Stem Cells (H9) Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Liver (HepG2) Prostate (RWPE1) Lung Heart
SNP sites on ESR1[chr17:2773298-2773316]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2773298 rs369004142 CCAGGGTGCGTTGACCTGCAGAG C 4704910
chr17 2773298 rs559706273 CCAGGGTGCGTTGACCTGCAGAG C 4704911
Genes possibly regulated by ESR1[chr17:2773298-2773316]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR1[chr17:2773298-2773316]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results