EnhancerDB
  1. Home
  2. TFBS
  3. NFE[chr17:64457983-64457987]
Chromosome characteristics of NFE[chr17:64457983-64457987]
Back to top
Enhancers possibly regulated by NFE[chr17:64457983-64457987]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 64453792 64473217 enh17315
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Bone (Osteoblast) Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on NFE[chr17:64457983-64457987]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 64457987 rs555316683 TCGAGGAGGAGACTGGGGTTCCTAACTAC T 4997874
chr17 64457987 rs73996208 T C 4997875
Genes possibly regulated by NFE[chr17:64457983-64457987]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFE[chr17:64457983-64457987]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results