EnhancerDB
  1. Home
  2. TFBS
  3. HIC2[chr17:80491655-80491664]
Chromosome characteristics of HIC2[chr17:80491655-80491664]
Back to top
Enhancers possibly regulated by HIC2[chr17:80491655-80491664]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80480565 80515355 enh4649
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Breast Spleen Muscle (Myotube) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on HIC2[chr17:80491655-80491664]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80491660 rs560232056 CCAGCTGTAGGTTAGCCGGGCGTGGTGACGCA C 5122752
Genes possibly regulated by HIC2[chr17:80491655-80491664]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HIC2[chr17:80491655-80491664]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results