Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr17 | 80814305 | 80837217 | enh17458 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr17 | 80822731 | rs527636053 | CGGGGCACCGTGGGGACAGCGGGGGCCTGCTCACTCCCT | C | 5125519 | |
chr17 | 80822731 | rs869212353 | CGGGGCACCGTGGGGACAGCGGGGGCCTGCTCACTCCCT | C | 5125520 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|