| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 80814305 | 80837217 | enh17458 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 80822731 | rs527636053 | CGGGGCACCGTGGGGACAGCGGGGGCCTGCTCACTCCCT | C | 5125519 | |
| chr17 | 80822731 | rs869212353 | CGGGGCACCGTGGGGACAGCGGGGGCCTGCTCACTCCCT | C | 5125520 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|