EnhancerDB
  1. Home
  2. TFBS
  3. ESR1[chr5:172260075-172260093]
Chromosome characteristics of ESR1[chr5:172260075-172260093]
Back to top
Enhancers possibly regulated by ESR1[chr5:172260075-172260093]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172258805 172341224 enh22817
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Lung (A549) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ESR1[chr5:172260075-172260093]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172260089 rs112676547 C CTGAATGAA,CTGAATGAATGAA,CTGAATGAATGAATGAA,CTGAATGAATGAATGAATGAA 8705375
chr5 172260089 rs70984915 C CTGAATGAATGAA 8705376
Genes possibly regulated by ESR1[chr5:172260075-172260093]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 172261278 172379688 + ERGIC1 ENSG00000113719.11 172261278 0.61 1.0 1185 5986
Expression level of Genes
Back to top
miRNAs possibly regulated by ESR1[chr5:172260075-172260093]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results