EnhancerDB
  1. Home
  2. TFBS
  3. SOX9[chr5:172441750-172441759]
Chromosome characteristics of SOX9[chr5:172441750-172441759]
Back to top
Enhancers possibly regulated by SOX9[chr5:172441750-172441759]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172432905 172446573 enh22818
Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
SNP sites on SOX9[chr5:172441750-172441759]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172441750 rs369607861 AGCACAATGGGTACAAACATGTGGGGTACCC A 8707116
chr5 172441750 rs550773917 AGCACAATGGGTACAAACATGTGGGGTACCC A 8707117
chr5 172441752 rs115911367 C T 8707118
chr5 172441754 rs116265365 C A 8707119
Genes possibly regulated by SOX9[chr5:172441750-172441759]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX9[chr5:172441750-172441759]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results