EnhancerDB
  1. Home
  2. TFBS
  3. JUND[chr5:172442542-172442557]
Chromosome characteristics of JUND[chr5:172442542-172442557]
Back to top
Enhancers possibly regulated by JUND[chr5:172442542-172442557]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 172432905 172446573 enh22818
Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
chr5 172442253 172442613 vista50200
VISTA
SNP sites on JUND[chr5:172442542-172442557]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 172442542 rs11276343 GGCCCGTGATGTAATCAATCAT G 8707129
chr5 172442542 rs113034607 GGCCCGTGATGTAATCAATCAT G 8707130
Genes possibly regulated by JUND[chr5:172442542-172442557]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by JUND[chr5:172442542-172442557]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results