Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11384253 rs545627214 ATGGGGTGGGGACAAGGGGGGAACAAGGGGAACCC A 4316430
chr16 11384269 rs111274070 G C 4316431

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results