EnhancerDB
  1. Home
  2. TFBS
  3. NR2F1[chr16:11389445-11389458]
Chromosome characteristics of NR2F1[chr16:11389445-11389458]
Back to top
Enhancers possibly regulated by NR2F1[chr16:11389445-11389458]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 11382725 11409295 enh3884
Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Stomach Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Blood (GM12878) Placenta Lung (PC-9) Spleen Muscle (Myotube) Liver (HepG2) Muscle (A673)
SNP sites on NR2F1[chr16:11389445-11389458]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11389450 rs369966800 T TGACCTCAAGTGATCCACCCAC 4316533
chr16 11389450 rs574849350 T TGACCTCAAGTGATCCACCCAC 4316534
chr16 11389458 rs4781059 A G 4316535
Genes possibly regulated by NR2F1[chr16:11389445-11389458]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR2F1[chr16:11389445-11389458]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results