EnhancerDB
  1. Home
  2. Gene
  3. POLD3[ENSG00000077514.4]
Enhancers that regulate POLD3[ENSG00000077514.4]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr11 74124885 74132315 enh28882 74204896 72581
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Blood (T-cell) Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Thyroid Breast Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
chr11 74138385 74142535 enh74831 74204896 62361
Muscle (A673) Brain (SK-N-MC)
chr11 74143745 74150795 enh28883 74204896 54101
Astrocyte Large Intestine
chr11 74151705 74162655 enh28884 74204896 42241
Prostate (PC-3) Brain (SK-N-SH) Brain (SK-N-MC) Astrocyte Stomach Muscle (A673) Thyroid Neural Stem Cells (H9) Epithelial (MCF-7)
chr11 74168665 74172815 enh90903 74204896 32081
Bone Marrow (K562)
chr11 74171904 74172163 vista10908 74204896 32733
VISTA
chr11 74176233 74176573 vista10909 74204896 28323
VISTA
chr11 74213285 74220175 enh14084 74204896 8389
Prostate (PC-3) Liver (HepG2) Large Intestine Esophagus Astrocyte Placenta Stomach
chr11 74228845 74236095 enh14085 74204896 23949
Prostate (PC-3) Placenta Spleen
chr11 74241645 74251975 enh14086 74204896 36749
Prostate (PC-3) Large Intestine Esophagus Placenta Peripheral Blood (MM.1S) Lung (PC-9) Stomach
chr11 74253105 74260835 enh50887 74204896 48209
Epithelial (MCF-7) Large Intestine Lung (PC-9) Pancreas Stomach
chr11 74257729 74258089 vista10910 74204896 52833
VISTA
chr11 74265305 74273235 enh28885 74204896 60409
Prostate (PC-3) Liver (HepG2) Astrocyte Thyroid Lung (PC-9) Spleen Heart
chr11 74279665 74284235 enh50888 74204896 74769
Pancreas Brain (SK-N-MC) Large Intestine
chr11 74287145 74295455 enh50889 74204896 82249
Large Intestine Peripheral Blood (MM.1S) Lung (PC-9) Pancreas Stomach
Transcript facotrs that regulate POLD3[ENSG00000077514.4]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with POLD3[ENSG00000077514.4], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr11 74398530 rs2000926 T C 18368 Esophagus 0.0382377 2106360
chr11 74387911 rs4944935 A G 7749 Esophagus 0.309199 2106216
chr11 75093269 rs73492857 T C 713107 Breast 0.456417 2109882
chr11 74672619 rs561117174 TCTGTTCACCCAGGCTAGAGTGCAATGGCACCATCTCGGCTCACTGCAAC T 292457 Uterus 0.47763 2107381
chr11 74322962 rs6592574 A G 0 Thyroid 0.00483433 2105707
chr11 75263560 rs191365535 G A 883398 Stomach 0.339119 2111129
Details of POLD3[ENSG00000077514.4]
Back to top
Genomic Location chr11:74204896-74380162[+]
TSS 74204896
Gene Name POLD3
Ensembl ID ENSG00000077514.4
ENTREZID 10714
Uniprot
Q15054
A0A024R5M8
Protein Name
DNA polymerase delta subunit 3
POLD3 protein
Polymerase
Expression levels of POLD3[ENSG00000077514.4]
Back to top