EnhancerDB
  1. Home
  2. Gene
  3. PARK7[ENSG00000116288.8]
Enhancers that regulate PARK7[ENSG00000116288.8]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr1 7927745 7931915 enh78949 8014351 82436
Prostate (PC-3) Cervix (HeLa-S3)
chr1 7944505 7965053 enh26518 8014351 49298
Prostate (PC-3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Colon (HCT116) Muscle (Myoblast) Pancreas Blood (T-cell)
chr1 7947650 7947935 vista211 8014351 66416
VISTA
chr1 7950902 7950918 vista212 8014351 63433
VISTA
chr1 7970025 7974495 enh95829 8014351 39856
Epithelial (MCF-7)
chr1 7987825 7992855 enh107365 8014351 21496
Blood (T-cell)
chr1 8001518 8001767 vista213 8014351 12584
VISTA
chr1 8033385 8037595 enh61786 8014351 19034
Ovary Esophagus Liver Spleen Uterus Stomach
chr1 8039565 8044729 enh61787 8014351 25214
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Ovary Esophagus Colon (HCT116) Breast Uterus Adrenal Pancreas (Panc1) Lung (PC-9) Pancreas Spleen Neural Stem Cells (H9) Stomach
chr1 8046025 8056395 enh11456 8014351 31674
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Placenta Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Neural Stem Cells (H9)
chr1 8054249 8054565 vista214 8014351 39898
VISTA
chr1 8061589 8069479 enh11457 8014351 47238
Esophagus Placenta Neural Stem Cells (H9)
chr1 8070132 8070398 vista215 8014351 55781
VISTA
chr1 8073125 8084015 enh11458 8014351 58774
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Placenta Thyroid Uterus Pancreas Neural Stem Cells (H9) Epithelial (MCF-7)
chr1 8076289 8076986 vista216 8014351 61938
VISTA
chr1 8089365 8111955 enh11459 8014351 75014
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr1 8107848 8108157 vista217 8014351 93497
VISTA
chr1 8113937 8146415 enh11460 8014351 99586
Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
Transcript facotrs that regulate PARK7[ENSG00000116288.8]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with PARK7[ENSG00000116288.8], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr1 8021973 rs35675666 G C,T 0 Esophagus 1.99006e-09 50046
chr1 8021973 rs35675666 G C,T 0 Esophagus 7.56621e-05 50046
chr1 7972247 rs60277886 TTAAAATAGAGCCAAATGGC T 42104 Esophagus 5.80214e-06 49709
chr1 8021740 rs17523802 G A 0 Heart 3.87702e-07 50038
chr1 8021910 rs373653682 GGTGCTGGACGGTGTCCCT G 0 Heart 1.26915e-06 50045
chr1 8056669 rs2745722 G A 11104 Breast 1.00294e-05 50345
chr1 8021910 rs373653682 GGTGCTGGACGGTGTCCCT G 0 Spleen 0.0137049 50045
chr1 8093006 rs141157193 T TA 47441 Ovary 0.168214 50657
chr1 8647481 rs79203748 A G 601916 Uterus 0.350386 57281
chr1 8022197 rs3766606 G T 0 Lung 8.89247e-08 50052
chr1 8014448 rs225115 C T 0 Stomach 0.00101384 49992
Details of PARK7[ENSG00000116288.8]
Back to top
Genomic Location chr1:8014351-8045565[+]
TSS 8014351
Gene Name PARK7
Ensembl ID ENSG00000116288.8
ENTREZID 11315
Uniprot
V9HWC2
Q99497
Protein Name
Protein DJ-1
Expression levels of PARK7[ENSG00000116288.8]
Back to top