EnhancerDB
  1. Home
  2. Gene
  3. RAB40B[ENSG00000141542.6]
Enhancers that regulate RAB40B[ENSG00000141542.6]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr17 80567145 80571895 enh17453 80656604 84709
Bone Marrow (K562) Brain (SK-N-MC) Muscle (A673) Placenta Heart
chr17 80592968 80593241 vista26473 80656604 63363
VISTA
chr17 80594524 80594906 vista26474 80656604 61698
VISTA
chr17 80624406 80647687 enh44509 80656604 8917
Skin (Keratinocyte) Prostate (PC-3) Large Intestine Prostate (RWPE1) Esophagus Ovary Lung Blood (OCI-LY7) Lung (A549) Stomach Muscle (Myoblast) Pancreas Muscle (Myotube) Uterus Heart
chr17 80655375 80655626 vista26475 80656604 978
VISTA
chr17 80663772 80669443 enh17454 80656604 7168
Prostate (RWPE1) Esophagus Blood (OCI-LY7) Placenta Muscle (Myoblast) Muscle (Myotube) Stomach
chr17 80700705 80704855 enh17455 80656604 44101
Placenta
chr17 80712796 80713169 vista26476 80656604 56192
VISTA
chr17 80730945 80736875 enh60694 80656604 74341
Muscle (A673) Ovary Blood (T-cell) Blood (OCI-LY7)
chr17 80738805 80755315 enh32383 80656604 82201
Prostate (PC-3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Muscle (A673) Peripheral Blood (MM.1S) Muscle (Myoblast) Breast Muscle (Myotube) Uterus Stomach
chr17 80745153 80745621 vista26477 80656604 88549
VISTA
chr17 80747083 80747366 vista26478 80656604 90479
VISTA
Transcript facotrs that regulate RAB40B[ENSG00000141542.6]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
chr17 80655002 80655522 ZNF143 ENCODE Uniform TFBS no Embryonic Stem Cell Line (H1-hESC) 80656604 1082 108312739
chr17 80655228 80656138 ZNF143 ENCODE Uniform TFBS no Embryonic Stem Cell Line (H1-hESC) 80656604 466 108312740
chr17 80655395 80655407 TFAP2A JASPAR yes 80656604 1197 21322737
chr17 80655395 80655407 TFAP2B JASPAR yes 80656604 1197 21322738
chr17 80655395 80655407 TFAP2C JASPAR yes 80656604 1197 21322739
chr17 80655395 80655410 TFAP2A JASPAR yes 80656604 1194 21322740
chr17 80655397 80655406 TFAP2A JASPAR yes 80656604 1198 21322741
chr17 80655403 80655414 E2F1 JASPAR yes 80656604 1190 21322742
chr17 80655409 80655420 FLI1 JASPAR yes 80656604 1184 21322743
chr17 80655410 80655418 EHF JASPAR yes 80656604 1186 21322744
chr17 80655416 80655421 SP1 TRANSFAC yes 80656604 1183 21322745
chr17 80655416 80655425 HIC2 JASPAR yes 80656604 1179 21322746
chr17 80655419 80655423 LFA1 TRANSFAC yes 80656604 1181 21322747
chr17 80655419 80655434 AR JASPAR yes 80656604 1170 21322748
chr17 80655440 80655455 TFAP2A JASPAR yes 80656604 1149 21322749
chr17 80655440 80655455 TFAP2C JASPAR yes 80656604 1149 21322750
chr17 80655443 80655454 TFAP2A JASPAR yes 80656604 1150 21322751
chr17 80655443 80655454 TFAP2B JASPAR yes 80656604 1150 21322752
chr17 80655443 80655454 TFAP2C JASPAR yes 80656604 1150 21322753
chr17 80655496 80655502 SP1 TRANSFAC yes 80656604 1102 21322754
chr17 80655541 80655551 MZF1 JASPAR yes 80656604 1053 21322755
chr17 80655544 80655554 SP1 JASPAR yes 80656604 1050 21322756
chr17 80655548 80655559 EBF1 JASPAR yes 80656604 1045 21322757
chr17 80655561 80655567 NFE2 TRANSFAC yes 80656604 1037 21322758
chr17 80655562 80655583 ZNF263 JASPAR yes 80656604 1021 21322759
chr17 80655565 80655571 SP1 TRANSFAC yes 80656604 1033 21322760
chr17 80655591 80655601 ZNF740 JASPAR yes 80656604 1003 21322761
SNPs associated with RAB40B[ENSG00000141542.6], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr17 80637631 rs148345099 G GCAGCCTCCACCAAGCACAGGCTAGGGACAGGGGC,GCC 0 Esophagus 0.0282134 5123841
chr17 81072056 rs34484437 A G 415452 Esophagus 0.265994 5128139
chr17 80546111 rs9897171 G A,C 66738 Esophagus 0.193949 5123322
chr17 80645286 rs2244312 C A,G 0 Heart 1.45173e-32 5123972
chr17 80645286 rs2244312 C A,G 0 Heart 3.9394e-20 5123972
chr17 81078168 rs537207617 A AT 421564 Pancreas 0.0589482 5128224
chr17 80628128 rs12949425 C G 0 Breast 0.4226 5123661
chr17 79944253 rs9904501 C T 668596 Ovary 0.312143 5117607
chr17 80645286 rs2244312 C A,G 0 Thyroid 1.98421e-46 5123972
chr17 81151539 rs35284141 T C 494935 Liver 0.189708 5128793
chr17 81021368 rs117081362 G A 364764 Lung 0.211623 5127154
chr17 79696321 rs193030143 G T 916528 Stomach 0.321178 5116141
chr17 80643394 rs2244565 G T 0 Adrenal 0.329151 5123930
Details of RAB40B[ENSG00000141542.6]
Back to top
Genomic Location chr17:80612849-80656604[-]
TSS 80656604
Gene Name RAB40B
Ensembl ID ENSG00000141542.6
ENTREZID 10966
Uniprot
Q12829
Protein Name
Ras-related protein Rab-40B
Expression levels of RAB40B[ENSG00000141542.6]
Back to top