EnhancerDB

Enhancers that regulate NSD1[ENSG00000165671.14]

Back to top

Chrom.	Start	End	Enhancer ID	TSS of gene	Distance between enhancer and TSS	Tissues that enhancer appears	More
chr5	176461065	176466175	enh72133	176560026	93851	Thyroid Neural Stem Cells (H9)
chr5	176495065	176501335	enh8890	176560026	58691	Large Intestine Astrocyte Blood (OCI-LY7) Blood (Karpas-422) Muscle (Myotube)
chr5	176519685	176524135	enh22856	176560026	35891	Placenta Stomach
chr5	176525697	176546095	enh22857	176560026	13931	Bone Marrow (K562) Liver (HepG2) Large Intestine Prostate (RWPE1) Ovary Blood (T-cell) Blood (OCI-LY7) Stomach Placenta Thyroid Muscle (Myoblast) Pancreas Uterus Thymus Epithelial (MCF-7)
chr5	176526460	176526848	vista50308	176560026	33178	VISTA
chr5	176543923	176544044	vista50309	176560026	15982	VISTA
chr5	176548904	176553815	enh61336	176560026	6211	Blood (OCI-LY7)
chr5	176565277	176569720	enh72134	176560026	5251	Neural Stem Cells (H9) Bone (Osteoblast)
chr5	176572325	176576475	enh38694	176560026	12299	Astrocyte
chr5	176582485	176586635	enh106148	176560026	22459	Peripheral Blood (MM.1S)
chr5	176586825	176590975	enh106149	176560026	26799	Peripheral Blood (MM.1S)
chr5	176596882	176607755	enh8891	176560026	36856	Brain (SK-N-MC) Blood (OCI-LY7) Thyroid Blood (Karpas-422) Pancreas
chr5	176614525	176618675	enh38695	176560026	54499	Astrocyte
chr5	176619147	176624923	enh38696	176560026	59121	Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Heart
chr5	176639405	176643555	enh101956	176560026	79379	Thyroid
chr5	176645745	176649895	enh101957	176560026	85719	Thyroid
chr5	176657829	176662535	enh38697	176560026	97803	Esophagus Astrocyte

Transcript facotrs that regulate NSD1[ENSG00000165671.14]

Back to top

Chrom.	Start	End	TF name	Source	Predicted site?	Tissue	TSS of gene	Distance between TFBS and gene	id	More

Chrom.	Position	dbSNP ID	Reference Allele	Alternative Allele	Distance between TSS and SNP	Tissue	q Value	id	More
chr5	177398372	rs70994948	GAGGACGAAGAGCTGGAGAGCGCCA	G	671156	Breast	0.270983	8733714
chr5	177511276	rs4379216	C	G	784060	Spleen	0.45773	8734160
chr5	175563817	rs35600445	C	G	996209	Uterus	0.342381	8726718
chr5	176414977	rs75476723	T	C	145049	Liver	0.376206	8730459

Genomic Location	chr5:176560026-176727216[+]
TSS	176560026
Gene Name	NSD1
Ensembl ID	ENSG00000165671.14
ENTREZID	64324
Uniprot
	Q96MN8
	Q96L73
Protein Name
	H3 lysine-36 and H4 lysine-20 specific
	H3 lysine-36 and H4 lysine-20-specific
	Alternative protein NSD1
	Histone-lysine N-methyltransferase
	Histone-lysine N-methyltransferase
	Histone-lysine N-methyltransferase
	NSD1 protein