EnhancerDB
  1. Home
  2. Gene
  3. MFSD4[ENSG00000174514.8]
Enhancers that regulate MFSD4[ENSG00000174514.8]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr1 205434093 205438243 enh67252 205538013 99770
Neural Stem Cells (H9)
chr1 205442172 205442546 vista4749 205538013 95467
VISTA
chr1 205444631 205456855 enh61954 205538013 81158
Prostate (PC-3) Cervix (HeLa-S3) Esophagus Stomach Muscle (A673) Colon (HCT116) Breast Peripheral Blood (MM.1S) Lung (PC-9) Pancreas Pancreas (Panc1) Neural Stem Cells (H9) Blood (T-cell) Epithelial (MCF-7)
chr1 205449878 205450140 vista4750 205538013 87873
VISTA
chr1 205459334 205467955 enh43117 205538013 70058
Liver (HepG2) Brain (SK-N-SH) Brain (SK-N-MC) Ovary Esophagus Stomach Muscle (A673) Muscle (Myotube) Uterus Heart
chr1 205466653 205467067 vista4751 205538013 70946
VISTA
chr1 205474556 205474866 vista4752 205538013 63147
VISTA
chr1 205475062 205491135 enh12592 205538013 46878
Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Lung Placenta Heart Stomach
chr1 205475126 205475451 vista4753 205538013 62562
VISTA
chr1 205502445 205516735 enh12593 205538013 21278
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Astrocyte Lung Stomach Placenta Lung (PC-9) Pancreas Heart
chr1 205510005 205510378 vista4754 205538013 27635
VISTA
chr1 205512470 205512827 vista4755 205538013 25186
VISTA
chr1 205516765 205520915 enh50151 205538013 17098
Large Intestine
chr1 205526738 205526752 vista4756 205538013 11261
VISTA
chr1 205542705 205546855 enh109375 205538013 4692
Stomach
chr1 205555905 205566855 enh894 205538013 17892
Blood (T-cell) Blood (Karpas-422) Stomach
chr1 205577265 205587875 enh895 205538013 39252
Prostate (PC-3) Astrocyte Blood (OCI-LY7) Stomach Blood (Karpas-422) Blood (T-cell) Epithelial (MCF-7)
chr1 205593445 205599915 enh896 205538013 55432
Blood (T-cell) Blood (Karpas-422)
chr1 205610085 205614235 enh92143 205538013 72072
Liver (HepG2)
chr1 205615545 205619695 enh87670 205538013 77532
Pancreas
chr1 205620125 205624395 enh79331 205538013 82112
Prostate (PC-3)
chr1 205631965 205647955 enh50152 205538013 93952
Large Intestine Prostate (RWPE1) Liver Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Pancreas Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
Transcript facotrs that regulate MFSD4[ENSG00000174514.8]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
chr1 205542712 205542729 RXRA JASPAR yes 205538013 4699 34770640
chr1 205542722 205542727 ETS2 TRANSFAC yes 205538013 4709 34770641
chr1 205542722 205542730 FEV JASPAR yes 205538013 4709 34770642
chr1 205542730 205542751 IRF1 JASPAR yes 205538013 4717 34770643
chr1 205542732 205542747 IRF9 JASPAR yes 205538013 4719 34770644
chr1 205542733 205542747 IRF8 JASPAR yes 205538013 4720 34770645
chr1 205542734 205542748 STAT1 JASPAR yes 205538013 4721 34770646
chr1 205542734 205542749 STAT2 JASPAR yes 205538013 4721 34770647
chr1 205542742 205542753 PHOX2A JASPAR yes 205538013 4729 34770648
chr1 205542742 205542753 PROP1 JASPAR yes 205538013 4729 34770649
chr1 205542757 205542772 TFAP2C JASPAR yes 205538013 4744 34770650
chr1 205542758 205542769 TFAP2A JASPAR yes 205538013 4745 34770651
chr1 205542758 205542769 TFAP2B JASPAR yes 205538013 4745 34770652
chr1 205542758 205542769 TFAP2C JASPAR yes 205538013 4745 34770653
chr1 205542759 205542768 TFAP2A JASPAR yes 205538013 4746 34770654
chr1 205542775 205542785 TBX21 JASPAR yes 205538013 4762 34770655
chr1 205542775 205542786 TBX20 JASPAR yes 205538013 4762 34770656
chr1 205542776 205542784 TBX5 JASPAR yes 205538013 4763 34770657
chr1 205542791 205542796 TFAP2A TRANSFAC yes 205538013 4778 34770658
chr1 205542791 205542797 MZF1 JASPAR yes 205538013 4778 34770659
chr1 205542803 205542813 POU6F1 JASPAR yes 205538013 4790 34770660
chr1 205542807 205542823 POU4F2 JASPAR yes 205538013 4794 34770661
chr1 205542812 205542816 TEAD2 TRANSFAC yes 205538013 4799 34770662
chr1 205542813 205542834 IRF1 JASPAR yes 205538013 4800 34770663
chr1 205542817 205542822 H4TF1 TRANSFAC yes 205538013 4804 34770664
chr1 205542819 205542840 IRF1 JASPAR yes 205538013 4806 34770665
chr1 205542821 205542836 FOXP1 JASPAR yes 205538013 4808 34770666
chr1 205542824 205542839 MEF2A JASPAR yes 205538013 4811 34770667
chr1 205542825 205542840 FOXP1 JASPAR yes 205538013 4812 34770668
chr1 205542825 205542840 MEF2C JASPAR yes 205538013 4812 34770669
chr1 205542825 205542846 IRF1 JASPAR yes 205538013 4812 34770670
chr1 205542826 205542838 FOXC2 JASPAR yes 205538013 4813 34770671
chr1 205542826 205542838 MEF2A JASPAR yes 205538013 4813 34770672
chr1 205542826 205542838 MEF2B JASPAR yes 205538013 4813 34770673
chr1 205542826 205542838 MEF2D JASPAR yes 205538013 4813 34770674
chr1 205542827 205542837 MEF2A JASPAR yes 205538013 4814 34770675
chr1 205542828 205542832 YY1 TRANSFAC yes 205538013 4815 34770676
chr1 205542829 205542841 IRF1 JASPAR yes 205538013 4816 34770677
chr1 205542829 205542843 IRF7 JASPAR yes 205538013 4816 34770678
chr1 205542832 205542844 MEF2D JASPAR yes 205538013 4819 34770679
chr1 205542834 205542838 YY1 TRANSFAC yes 205538013 4821 34770680
chr1 205542905 205542915 SP1 JASPAR yes 205538013 4892 34770681
chr1 205542906 205542916 SP1 JASPAR yes 205538013 4893 34770682
chr1 205542932 205542947 TFAP2A JASPAR yes 205538013 4919 34770683
chr1 205542932 205542947 TFAP2C JASPAR yes 205538013 4919 34770684
chr1 205542935 205542946 TFAP2A JASPAR yes 205538013 4922 34770685
chr1 205542935 205542946 TFAP2B JASPAR yes 205538013 4922 34770686
chr1 205542935 205542946 TFAP2C JASPAR yes 205538013 4922 34770687
chr1 205542935 205542947 TFAP2B JASPAR yes 205538013 4922 34770688
chr1 205542935 205542947 TFAP2C JASPAR yes 205538013 4922 34770689
chr1 205542994 205543009 MEF2A JASPAR yes 205538013 4981 34770690
chr1 205542995 205543010 MEF2C JASPAR yes 205538013 4982 34770691
chr1 205542996 205543008 MEF2A JASPAR yes 205538013 4983 34770692
chr1 205542996 205543008 MEF2B JASPAR yes 205538013 4983 34770693
chr1 205542996 205543008 MEF2D JASPAR yes 205538013 4983 34770694
chr1 205542998 205543002 YY1 TRANSFAC yes 205538013 4985 34770695
chr1 205543010 205543022 PKNOX1 JASPAR yes 205538013 4997 34770696
chr1 205543010 205543022 TGIF1 JASPAR yes 205538013 4997 34770697
chr1 205543010 205543022 TGIF2 JASPAR yes 205538013 4997 34770698
SNPs associated with MFSD4[ENSG00000174514.8], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr1 205543287 rs114172378 C A 0 Esophagus 0.000728085 884744
chr1 205560119 rs7539751 T C 0 Esophagus 9.65989e-07 884839
chr1 205562202 rs7553871 G A 0 Esophagus 0.00477519 884865
chr1 205513188 rs11273569 T TTTACAACACCTGACCCCAACTTGGGACTTGGGATGGC 24825 Heart 0.115598 884467
chr1 205516832 rs11240513 G A,T 21181 Breast 0.40474 884507
chr1 204710245 rs73076071 G A 827768 Spleen 0.344357 878821
chr1 205560119 rs7539751 T C 0 Thyroid 0.00485292 884839
chr1 205602677 rs6593959 G A 30631 Liver 0.256943 885274
chr1 205543767 rs7534154 C T 0 Lung 0.0144056 884748
chr1 205204973 rs111672309 G C 333040 Adrenal 0.195633 881368
Details of MFSD4[ENSG00000174514.8]
Back to top
Genomic Location chr1:205538013-205572046[+]
TSS 205538013
Gene Name MFSD4
Ensembl ID ENSG00000174514.8
ENTREZID
Uniprot
Protein Name
isoform CRA_a
isoform CRA_c
MFSD4 protein
Major facilitator superfamily domain containing 4
Major facilitator superfamily domain containing 4
Major facilitator superfamily domain-containing protein 4A
Expression levels of MFSD4[ENSG00000174514.8]
Back to top