EnhancerDB
  1. Home
  2. Gene
  3. SDR42E2[ENSG00000183921.5]
Enhancers that regulate SDR42E2[ENSG00000183921.5]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr16 22079774 22086763 enh58700 22177618 90855
Skin (Keratinocyte) Esophagus Stomach Pancreas Pancreas (Panc1) Uterus Heart
chr16 22082738 22082854 vista22124 22177618 94764
VISTA
chr16 22173501 22173827 vista22125 22177618 3791
VISTA
chr16 22184105 22188255 enh104225 22177618 6487
Peripheral Blood (MM.1S)
chr16 22199323 22212535 enh3938 22177618 21705
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Blood (GM12878) Placenta Colon (HCT116) Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Uterus
chr16 22201170 22202123 vista22126 22177618 23552
VISTA
chr16 22202219 22202462 vista22127 22177618 24601
VISTA
chr16 22202596 22202946 vista22128 22177618 24978
VISTA
chr16 22203475 22203890 vista22129 22177618 25857
VISTA
chr16 22206155 22206271 vista22130 22177618 28537
VISTA
chr16 22207042 22207397 vista22131 22177618 29424
VISTA
chr16 22211037 22211162 vista22132 22177618 33419
VISTA
chr16 22219345 22234480 enh3939 22177618 41727
Bone Marrow (K562) Prostate (PC-3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung Blood (OCI-LY7) Stomach Placenta Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Uterus Thymus Heart
chr16 22221382 22221539 vista22133 22177618 43764
VISTA
chr16 22227582 22228085 vista22134 22177618 49964
VISTA
chr16 22229382 22229580 vista22135 22177618 51764
VISTA
chr16 22241325 22254555 enh3940 22177618 63707
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Blood (T-cell) Stomach Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Pancreas Spleen Uterus Thymus Heart
Transcript facotrs that regulate SDR42E2[ENSG00000183921.5]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
chr16 22173474 22174084 ZNF143 ENCODE Uniform TFBS no Embryonic Stem Cell Line (H1-hESC) 22177618 3534 108187378
chr16 22173520 22173530 MEF2A JASPAR yes 22177618 4088 49354048
chr16 22173562 22173569 E2F1 TRANSFAC yes 22177618 4049 49354049
chr16 22173592 22173606 NR2F1 JASPAR yes 22177618 4012 49354050
chr16 22173594 22173870 ZNF143 ENCODE Uniform TFBS no Embryonic Stem Cell Line (H1-hESC) 22177618 3748 108187379
chr16 22173605 22173929 ZNF143 ENCODE Uniform TFBS no Embryonic Stem Cell Line (H1-hESC) 22177618 3689 108187380
chr16 22173626 22174282 ZNF217 ENCODE Uniform TFBS no Epithelial (MCF-7) 22177618 3336 108187381
chr16 22173627 22173631 YY1 TRANSFAC yes 22177618 3987 49354051
chr16 22173638 22174102 ZBTB33 ENCODE Uniform TFBS no Colon (HCT116) 22177618 3516 108187382
chr16 22173649 22173664 STAT2 JASPAR yes 22177618 3954 49354052
chr16 22173650 22173664 STAT1 JASPAR yes 22177618 3954 49354053
chr16 22173655 22173670 PRDM1 JASPAR yes 22177618 3948 49354054
chr16 22173675 22173684 TFAP2A JASPAR yes 22177618 3934 49354055
chr16 22173688 22173693 USF2 TRANSFAC yes 22177618 3925 49354056
chr16 22173700 22173709 SNAI2 JASPAR yes 22177618 3909 49354057
chr16 22173700 22173710 ID4 JASPAR yes 22177618 3908 49354058
chr16 22173700 22173710 TCF3 JASPAR yes 22177618 3908 49354059
chr16 22173700 22173710 TCF4 JASPAR yes 22177618 3908 49354060
chr16 22173706 22173717 E2F4 JASPAR yes 22177618 3901 49354061
chr16 22173706 22173717 E2F6 JASPAR yes 22177618 3901 49354062
chr16 22173707 22173718 E2F1 JASPAR yes 22177618 3900 49354063
chr16 22173724 22173729 SP1 TRANSFAC yes 22177618 3889 49354064
chr16 22173725 22173730 SP1 TRANSFAC yes 22177618 3888 49354065
chr16 22173725 22173734 THAP1 JASPAR yes 22177618 3884 49354066
chr16 22173728 22173732 LFA1 TRANSFAC yes 22177618 3886 49354067
chr16 22173740 22173745 SP1 TRANSFAC yes 22177618 3873 49354068
chr16 22173741 22173746 SP1 TRANSFAC yes 22177618 3872 49354069
chr16 22173741 22173747 SP1 TRANSFAC yes 22177618 3871 49354070
chr16 22173745 22173752 SP1 TRANSFAC yes 22177618 3866 49354071
chr16 22173747 22173752 SP1 TRANSFAC yes 22177618 3866 49354072
chr16 22173751 22173755 H4TF2 TRANSFAC yes 22177618 3863 49354073
chr16 22173767 22173774 SP1 TRANSFAC yes 22177618 3844 49354074
chr16 22173768 22173773 SP1 TRANSFAC yes 22177618 3845 49354075
chr16 22173768 22173774 SP1 TRANSFAC yes 22177618 3844 49354076
chr16 22173770 22173779 SP1 TRANSFAC yes 22177618 3839 49354077
chr16 22173771 22173777 SP1 TRANSFAC yes 22177618 3841 49354078
chr16 22173771 22173781 SP1 JASPAR yes 22177618 3837 49354079
chr16 22173772 22173779 SP1 TRANSFAC yes 22177618 3839 49354080
chr16 22173773 22173778 SP1 TRANSFAC yes 22177618 3840 49354081
chr16 22173773 22173779 SP1 TRANSFAC yes 22177618 3839 49354082
chr16 22173774 22173795 ZNF263 JASPAR yes 22177618 3823 49354083
chr16 22173775 22173784 SP1 TRANSFAC yes 22177618 3834 49354084
chr16 22173776 22173782 SP1 TRANSFAC yes 22177618 3836 49354085
chr16 22173776 22173786 SP1 JASPAR yes 22177618 3832 49354086
chr16 22173777 22173784 SP1 TRANSFAC yes 22177618 3834 49354087
chr16 22173778 22173783 SP1 TRANSFAC yes 22177618 3835 49354088
chr16 22173778 22173784 SP1 TRANSFAC yes 22177618 3834 49354089
chr16 22173779 22173800 ZNF263 JASPAR yes 22177618 3818 49354090
SNPs associated with SDR42E2[ENSG00000183921.5], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr16 22635905 rs376348960 G A 432830 Esophagus 0.3168 4371906
chr16 22637254 rs56901548 G GGACTTGGATAGAACTTACTGCATCA 434179 Breast 0.313265 4371940
chr16 22979665 rs35805389 AT A 776590 Spleen 0.329613 4373231
chr16 23136027 rs143575415 T A 932952 Thyroid 0.254036 4373651
chr16 22173868 rs114431989 C G 3750 Lung 0.0810078 4370411
Details of SDR42E2[ENSG00000183921.5]
Back to top
Genomic Location chr16:22177618-22203075[+]
TSS 22177618
Gene Name SDR42E2
Ensembl ID ENSG00000183921.5
ENTREZID 100288072
Uniprot
Protein Name
Putative short-chain dehydrogenase/reductase family 42E member 2
Expression levels of SDR42E2[ENSG00000183921.5]
Back to top