EnhancerDB
  1. Home
  2. TFBS
  3. EP300[chr1:202003967-202004646]
Chromosome characteristics of EP300[chr1:202003967-202004646]
Back to top
Enhancers possibly regulated by EP300[chr1:202003967-202004646]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 201996265 202020435 enh12533
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Kidney Stomach Epithelial (MCF-7) Bone (Osteoblast) Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Muscle (A673)
chr1 202003884 202004146 vista4589
VISTA
SNP sites on EP300[chr1:202003967-202004646]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 202003987 rs6694034 A C 859134
chr1 202004069 rs114473276 G A,T 859135
chr1 202004111 rs192923589 G A 859136
chr1 202004204 rs4434889 G C 859137
chr1 202004233 rs183911587 G C 859138
chr1 202004254 rs11267336 A ATGGTCACATACCTAAGTATGTG 859139
chr1 202004356 rs116756971 A G 859140
chr1 202004365 rs139313090 A G 859141
chr1 202004405 rs79307954 G A 859142
chr1 202004543 rs180783006 C A 859143
chr1 202004563 rs558836028 T A 859144
chr1 202004570 rs186370942 T C 859145
chr1 202004577 rs376164691 G A 859146
Genes possibly regulated by EP300[chr1:202003967-202004646]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by EP300[chr1:202003967-202004646]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results