EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212455337-212458699]
Chromosome characteristics of ZNF274[chr1:212455337-212458699]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212455337-212458699]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212456045 212470579 enh910
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Bone (Osteoblast) Lung Blood (OCI-LY7) Blood (GM12878) Colon (HCT116) Uterus Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Neural Stem Cells (H9) Stomach
chr1 212458080 212458253 vista4993
VISTA
SNP sites on ZNF274[chr1:212455337-212458699]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212455457 rs564063794 T C 922177
chr1 212455459 rs543250688 A T 922178
chr1 212455546 rs548667842 T G 922179
chr1 212455615 rs60550755 A G 922180
chr1 212455805 rs72752370 C A 922181
chr1 212455845 rs12402642 T C 922182
chr1 212455865 rs190787171 C T 922183
chr1 212455936 rs7519301 G A 922184
chr1 212456044 rs187941497 G T 922185
chr1 212456068 rs144119184 C G 922186
chr1 212456109 rs6666970 G C 922187
chr1 212456230 rs544395933 TTC T 922188
chr1 212456232 rs192414311 C G 922189
chr1 212456280 rs6658490 T C 922190
chr1 212456343 rs6667199 G A 922191
chr1 212456549 rs563450453 TGAC T 922192
chr1 212456621 rs79543712 T C 922193
chr1 212456632 rs72752373 T C 922194
chr1 212456682 rs536909002 T A,C 922195
chr1 212456683 rs201813495 G GA 922196
chr1 212456714 rs12036130 C T 922197
chr1 212456723 rs11119903 T C 922198
chr1 212456752 rs114846806 G A,C 922199
chr1 212456786 rs112690219 G C 922200
chr1 212456869 rs374321571 G A,C,T 922201
chr1 212456905 rs548007221 G A 922202
chr1 212457155 rs116735748 A G 922203
chr1 212457237 rs6661987 T C 922204
chr1 212457293 rs142852528 T C,G 922205
chr1 212457340 rs115325884 T G 922206
chr1 212457414 rs351413 A G 922207
chr1 212457480 rs529641396 C G,T 922208
chr1 212457622 rs2236597 T C 922209
chr1 212457845 rs184197889 C A 922210
chr1 212457885 rs139905916 A G 922211
chr1 212457974 rs542933487 AGTAGCTCTCTGGAGTTGCG A 922212
chr1 212457987 rs72752376 A G 922213
chr1 212458011 rs568326352 G C 922214
chr1 212458049 rs72752377 T C,G 922215
chr1 212458123 rs351412 C T 922216
chr1 212458127 rs76606646 C T 922217
chr1 212458242 rs114170887 C A 922218
chr1 212458285 rs530566198 A G 922219
chr1 212458317 rs968532 G T 922220
chr1 212458327 rs567219084 A G 922221
chr1 212458357 rs546850527 G A 922222
chr1 212458383 rs968531 G A,C 922223
chr1 212458391 rs2236598 G A 922224
chr1 212458481 rs116152882 G A 922225
chr1 212458620 rs113386004 C A 922226
chr1 212458622 rs351411 C T 922227
chr1 212458645 rs560846174 G A 922228
Genes possibly regulated by ZNF274[chr1:212455337-212458699]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 212458879 212535200 + PPP2R5A ENSG00000066027.7 212458879 0.76 0.99 180 1825
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr1:212455337-212458699]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results