EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85421249-85425869]
Chromosome characteristics of TCF7L2[chr16:85421249-85425869]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85421249-85425869]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85390172 85421515 enh16868
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-MC) Large Intestine Brain (SK-N-SH) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Thyroid Lung (PC-9) Pancreas Muscle (Myotube) Heart
chr16 85422125 85439595 enh4173
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Stomach Epithelial (MCF-7) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673)
chr16 85424430 85424739 vista23302
VISTA
SNP sites on TCF7L2[chr16:85421249-85425869]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85421466 rs147248119 T C 4622060
chr16 85421473 rs113726319 A G 4622061
chr16 85421526 rs145088680 G GTGGA,GTGGATGGA 4622062
chr16 85421526 rs58007210 G GTGGA 4622063
chr16 85421526 rs757095310 G GTGGA 4622064
chr16 85421527 rs570529076 T A 4622065
chr16 85421550 rs141481563 A T 4622066
chr16 85421602 rs138569261 A G 4622067
chr16 85421682 rs146696687 G GTGGA 4622068
chr16 85421682 rs397727206 G GTGGA 4622069
chr16 85421682 rs59285749 G GTGGA 4622070
chr16 85421682 rs771025165 G GTGGA 4622071
chr16 85421849 rs201742669 G A 4622072
chr16 85421954 rs62648810 A G 4622073
chr16 85421956 rs62648811 G A 4622074
chr16 85422006 rs542762822 A G 4622075
chr16 85422056 rs531002874 G T 4622076
chr16 85422057 rs370795638 A G 4622077
chr16 85422058 rs570657425 G C 4622078
chr16 85422136 rs57516136 T G 4622079
chr16 85422191 rs567106607 T G 4622080
chr16 85422202 rs555892931 A G 4622081
chr16 85422300 rs145967592 A G 4622082
chr16 85422407 rs547258019 G C 4622083
chr16 85422503 rs900760 G C 4622084
chr16 85422567 rs564198269 G T 4622085
chr16 85422592 rs533252918 A G 4622086
chr16 85422598 rs546560113 A G 4622087
chr16 85422602 rs78323332 A G 4622088
chr16 85422686 rs141455982 C A 4622089
chr16 85422753 rs73259305 A T 4622090
chr16 85422894 rs113302068 C T 4622091
chr16 85422910 rs192403910 A G 4622092
chr16 85422939 rs7189517 A G 4622093
chr16 85423052 rs568627265 C T 4622094
chr16 85423053 rs113687236 G A 4622095
chr16 85423100 rs370232259 G T 4622096
chr16 85423221 rs59119214 C G 4622097
chr16 85423279 rs55680316 C T 4622098
chr16 85423287 rs56969252 C T 4622099
chr16 85423387 rs78354800 C T 4622100
chr16 85423435 rs79890475 A T 4622101
chr16 85423454 rs369819548 AGGGGCGTCACTT A 4622102
chr16 85423566 rs142914094 C T 4622103
chr16 85423856 rs146127162 C T 4622104
chr16 85423899 rs562924116 A C 4622105
chr16 85423996 rs565608155 G A 4622106
chr16 85424029 rs78223580 G A 4622107
chr16 85424077 rs61030331 T C 4622108
chr16 85424163 rs11149741 G C 4622109
chr16 85424252 rs111666483 A G 4622110
chr16 85424314 rs56399847 C CA 4622111
chr16 85424332 rs554754602 C T 4622112
chr16 85424379 rs35349949 T C 4622113
chr16 85424432 rs12929619 T G 4622114
chr16 85424556 rs66907603 G A 4622115
chr16 85424564 rs550716167 G A,C 4622116
chr16 85424605 rs376688311 G A 4622117
chr16 85424634 rs551765883 C A,T 4622118
chr16 85424700 rs369022209 C A,G 4622119
chr16 85424704 rs191896320 G A 4622120
chr16 85424882 rs545372417 C T 4622121
chr16 85424896 rs139062384 A C 4622122
chr16 85424946 rs541694259 A G 4622123
chr16 85424961 rs530312983 C T 4622124
chr16 85425167 rs557476015 C T 4622125
chr16 85425182 rs149904569 C T 4622126
chr16 85425229 rs144924517 C T 4622127
chr16 85425237 rs900761 G A 4622128
chr16 85425361 rs193160681 G A 4622129
chr16 85425370 rs566373236 AGGTCACTGGAGTAGATGCTTGTGG A 4622130
chr16 85425400 rs560404777 C T 4622131
chr16 85425425 rs369734045 C G,T 4622132
chr16 85425441 rs115915838 T C 4622133
chr16 85425496 rs185021033 G A 4622134
chr16 85425691 rs57231718 C A,G,T 4622135
chr16 85425733 rs112946218 G T 4622136
chr16 85425756 rs117636301 C T 4622137
Genes possibly regulated by TCF7L2[chr16:85421249-85425869]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85421249-85425869]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results