EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:89405111-89406360]
Chromosome characteristics of ZNF274[chr16:89405111-89406360]
Back to top
Enhancers possibly regulated by ZNF274[chr16:89405111-89406360]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89371847 89409975 enh16905
Bone Marrow (K562) Liver Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr16 89406185 89406252 vista23564
VISTA
SNP sites on ZNF274[chr16:89405111-89406360]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89405257 rs533841630 T C 4675146
chr16 89405321 rs188094305 A G 4675147
chr16 89405337 rs190790485 G A 4675148
chr16 89405446 rs115687488 C T 4675149
chr16 89405617 rs144386908 A G 4675150
chr16 89405686 rs148351428 C A 4675151
chr16 89405758 rs187956315 C T 4675152
chr16 89405763 rs113752085 GCAAACAAA G 4675153
chr16 89405763 rs372784997 GCAAACAAA G 4675154
chr16 89405763 rs527987508 GCAAACAAA G 4675155
chr16 89405763 rs530198586 GCAAACAAACAAA G 4675156
chr16 89405763 rs532115268 G GCAAA 4675157
chr16 89405788 rs538344423 CAA C 4675158
chr16 89405827 rs2353030 T C 4675159
chr16 89405863 rs144590400 GAGCCCATCCTGCCCTGAGTGCACGC G 4675160
chr16 89405863 rs370053471 GAGCCCATCCTGCCCTGAGTGCACGC G 4675161
chr16 89405867 rs533757865 C G 4675162
chr16 89405898 rs570453121 G C 4675163
chr16 89405923 rs142101349 T C 4675164
chr16 89405956 rs76634941 C G 4675165
chr16 89406064 rs572930380 A T 4675166
chr16 89406095 rs540265211 G C 4675167
chr16 89406200 rs139167630 C T 4675168
chr16 89406228 rs144030720 G A 4675169
chr16 89406242 rs184653991 G C 4675170
chr16 89406303 rs150518874 C T 4675171
chr16 89406351 rs115611907 T C 4675172
Genes possibly regulated by ZNF274[chr16:89405111-89406360]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:89405111-89406360]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results