EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:1173105-1175935]
Chromosome characteristics of ZNF274[chr19:1173105-1175935]
Back to top
Enhancers possibly regulated by ZNF274[chr19:1173105-1175935]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1159608 1173238 enh17838
Bone Marrow (K562) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Placenta Thyroid Uterus Stomach
chr19 1174025 1184042 enh17839
Skin (Keratinocyte) Prostate (PC-3) Large Intestine Esophagus Stomach Placenta Thyroid Lung (PC-9) Pancreas Epithelial (MCF-7)
chr19 1172839 1173266 vista28145
VISTA
chr19 1175432 1175562 vista28146
VISTA
SNP sites on ZNF274[chr19:1173105-1175935]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1173279 rs148800518 ACTCGGGCCAT A 5372767
chr19 1173279 rs374074231 ACTCGGGCCAT A 5372768
chr19 1173313 rs561607417 G A 5372769
chr19 1173554 rs55961439 A G 5372770
chr19 1173824 rs188011428 G A 5372771
chr19 1173826 rs111467467 G T 5372772
chr19 1173827 rs180784229 G A 5372773
chr19 1173840 rs372096825 C T 5372774
chr19 1173866 rs557422584 G A 5372775
chr19 1173893 rs117830785 A G 5372776
chr19 1174016 rs568596329 G GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA 5372777
chr19 1174022 rs555650715 G A 5372778
chr19 1174313 rs564527169 C G 5372779
chr19 1174316 rs531966652 G T 5372780
chr19 1174317 rs201384443 C CG 5372781
chr19 1174349 rs550360871 A C 5372782
chr19 1174401 rs376386875 C T 5372783
chr19 1174407 rs140554381 C G,T 5372784
chr19 1174414 rs873073 G A,C,T 5372785
chr19 1174553 rs188506748 C A 5372786
chr19 1174602 rs873074 C T 5372787
chr19 1174612 rs79563012 C T 5372788
chr19 1174801 rs7507718 G A 5372789
chr19 1174825 rs186542856 C A 5372790
chr19 1174857 rs117462734 G A 5372791
chr19 1175018 rs192379317 C G 5372792
chr19 1175022 rs75920709 C T 5372793
chr19 1175035 rs148906515 C G 5372794
chr19 1175161 rs116561726 C T 5372795
chr19 1175261 rs10420271 G A 5372796
chr19 1175396 rs873289 A G 5372797
chr19 1175454 rs559634508 C G 5372798
chr19 1175555 rs562984724 A G 5372799
chr19 1175699 rs142433430 A ACAGTC 5372800
chr19 1175699 rs375607369 A ACAGTC 5372801
chr19 1175794 rs150931391 G A,C,T 5372802
chr19 1175803 rs140794366 C T 5372803
chr19 1175841 rs4807644 G A 5372804
chr19 1175887 rs4807645 G A 5372805
Genes possibly regulated by ZNF274[chr19:1173105-1175935]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1107636 1174282 - SBNO2 ENSG00000064932.11 1174282 0.75 1.0 1177 16735
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr19:1173105-1175935]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results