EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212457563-212459541]
Chromosome characteristics of ZNF274[chr1:212457563-212459541]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212457563-212459541]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212456045 212470579 enh910
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Bone (Osteoblast) Lung Blood (OCI-LY7) Blood (GM12878) Colon (HCT116) Uterus Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Neural Stem Cells (H9) Stomach
chr1 212458080 212458253 vista4993
VISTA
SNP sites on ZNF274[chr1:212457563-212459541]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212457622 rs2236597 T C 922209
chr1 212457845 rs184197889 C A 922210
chr1 212457885 rs139905916 A G 922211
chr1 212457974 rs542933487 AGTAGCTCTCTGGAGTTGCG A 922212
chr1 212457987 rs72752376 A G 922213
chr1 212458011 rs568326352 G C 922214
chr1 212458049 rs72752377 T C,G 922215
chr1 212458123 rs351412 C T 922216
chr1 212458127 rs76606646 C T 922217
chr1 212458242 rs114170887 C A 922218
chr1 212458285 rs530566198 A G 922219
chr1 212458317 rs968532 G T 922220
chr1 212458327 rs567219084 A G 922221
chr1 212458357 rs546850527 G A 922222
chr1 212458383 rs968531 G A,C 922223
chr1 212458391 rs2236598 G A 922224
chr1 212458481 rs116152882 G A 922225
chr1 212458620 rs113386004 C A 922226
chr1 212458622 rs351411 C T 922227
chr1 212458645 rs560846174 G A 922228
chr1 212458750 rs532399411 C T 922229
chr1 212458782 rs569041099 G T 922230
chr1 212458816 rs368677893 G A 922231
chr1 212458946 rs111653872 G T 922232
chr1 212459015 rs17042034 G T 922233
chr1 212459034 rs561026800 G T 922234
chr1 212459035 rs572896920 C T 922235
chr1 212459056 rs540330046 T C 922236
chr1 212459226 rs562670692 G A 922237
chr1 212459257 rs351409 A G 922238
chr1 212459286 rs548126670 C T 922239
chr1 212459454 rs572979647 T TGTC 922240
chr1 212459454 rs773826472 T TGTC 922241
chr1 212459470 rs140143936 G C 922242
Genes possibly regulated by ZNF274[chr1:212457563-212459541]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 212458879 212535200 + PPP2R5A ENSG00000066027.7 212458879 0.76 0.99 662 1825
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr1:212457563-212459541]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results