EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr12:52515661-52515895]
Chromosome characteristics of ZZZ3[chr12:52515661-52515895]
Back to top
Enhancers possibly regulated by ZZZ3[chr12:52515661-52515895]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52508085 52522855 enh2356
Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Spleen Liver (HepG2) Muscle (A673) Heart
SNP sites on ZZZ3[chr12:52515661-52515895]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52515799 rs111330349 C G 2635600
chr12 52515872 rs531109266 C T 2635601
chr12 52515872 rs543122650 C CCCCCACCCCTCTCTCCCTCCAAGA 2635602
Genes possibly regulated by ZZZ3[chr12:52515661-52515895]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr12:52515661-52515895]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results