EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr12:52612804-52613302]
Chromosome characteristics of ZNF143[chr12:52612804-52613302]
Back to top
Enhancers possibly regulated by ZNF143[chr12:52612804-52613302]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52591245 52620175 enh14727
Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF143[chr12:52612804-52613302]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52612835 rs147671455 C T 2637010
chr12 52612872 rs78101408 A G 2637011
chr12 52612942 rs6580867 C T 2637012
chr12 52612993 rs6580868 T C 2637013
chr12 52613105 rs144748299 T G 2637014
chr12 52613122 rs574997353 AC A 2637015
chr12 52613135 rs563745171 G GTATC,GTATCTATC,GTATCTATGTATGTATGTATGTATGTATGTATGTATC 2637016
chr12 52613151 rs111419982 C G 2637017
chr12 52613159 rs199984562 C G 2637018
chr12 52613221 rs146122304 C CATCT 2637019
chr12 52613289 rs148266199 T C 2637020
Genes possibly regulated by ZNF143[chr12:52612804-52613302]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr12:52612804-52613302]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results