EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:28050010-28050464]
Chromosome characteristics of ZNF274[chr17:28050010-28050464]
Back to top
Enhancers possibly regulated by ZNF274[chr17:28050010-28050464]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 28029886 28064015 enh4330
Bone Marrow (K562) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Prostate (RWPE1) Muscle (A673) Heart
chr17 28049478 28050072 vista24357
VISTA
SNP sites on ZNF274[chr17:28050010-28050464]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 28050121 rs533409366 TGCAAGATATCCCATCTCTGTGG T 4818055
chr17 28050275 rs114617872 G A 4818056
chr17 28050331 rs78410453 T C 4818057
chr17 28050369 rs145856347 G A 4818058
Genes possibly regulated by ZNF274[chr17:28050010-28050464]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:28050010-28050464]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results