EnhancerDB
  1. Home
  2. TFBS
  3. P63[chr17:41517754-41520458]
Chromosome characteristics of P63[chr17:41517754-41520458]
Back to top
Enhancers possibly regulated by P63[chr17:41517754-41520458]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 41518125 41539515 enh17169
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Kidney Prostate (RWPE1) Cervix (HeLa-S3) Esophagus Astrocyte Lung (A549) Stomach Placenta Thyroid Adrenal Lung (PC-9) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on P63[chr17:41517754-41520458]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 41517801 rs571205871 G A 4883488
chr17 41517802 rs528806229 C A 4883489
chr17 41517884 rs78249048 G A 4883490
chr17 41517976 rs575175056 T TG,TTTG 4883491
chr17 41517979 rs375419538 G A,T 4883492
chr17 41518189 rs539459606 T G 4883493
chr17 41518252 rs537283075 C G,T 4883494
chr17 41518253 rs149739170 G A 4883495
chr17 41518263 rs573535277 C A 4883496
chr17 41518356 rs148820758 T A 4883497
chr17 41518358 rs111753984 CA C 4883498
chr17 41518446 rs376669605 A T 4883499
chr17 41518449 rs182199966 T C 4883500
chr17 41518581 rs188100578 G C 4883501
chr17 41518583 rs142566526 C T 4883502
chr17 41518649 rs11410574 G GT 4883503
chr17 41518649 rs398030902 G GT 4883504
chr17 41518746 rs77496946 C A 4883505
chr17 41518891 rs556096914 C A 4883506
chr17 41518899 rs200855583 G A 4883507
chr17 41518910 rs140675511 G A,C 4883508
chr17 41518927 rs12948694 G A 4883509
chr17 41518972 rs4793250 G A 4883510
chr17 41519032 rs546901031 ACCAATAAGAGGCAGAGCTCTGCCCAGGACCAATCAAAGGCAT A 4883511
chr17 41519080 rs192886644 C A 4883512
chr17 41519113 rs116076785 G C 4883513
chr17 41519147 rs370750272 G C 4883514
chr17 41519513 rs373744464 G A 4883515
chr17 41519544 rs73314981 T A 4883516
chr17 41519578 rs76550968 G T 4883517
chr17 41519589 rs73314982 G A 4883518
chr17 41519660 rs558329619 T C 4883519
chr17 41519729 rs71382966 A C 4883520
chr17 41519734 rs9904812 T C 4883521
chr17 41519745 rs555801640 G A 4883522
chr17 41519904 rs138401565 G A 4883523
chr17 41519923 rs56125357 A G 4883524
chr17 41519990 rs546663571 A G 4883525
chr17 41520200 rs7207025 G A 4883526
Genes possibly regulated by P63[chr17:41517754-41520458]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by P63[chr17:41517754-41520458]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results