EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:48971699-48973033]
Chromosome characteristics of ZNF274[chr17:48971699-48973033]
Back to top
Enhancers possibly regulated by ZNF274[chr17:48971699-48973033]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48954425 48973436 enh32228
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Stomach Epithelial (MCF-7) Skin (Keratinocyte) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1)
SNP sites on ZNF274[chr17:48971699-48973033]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48971758 rs575014292 G A 4926651
chr17 48971825 rs56119751 C T 4926652
chr17 48972064 rs143593018 A G 4926653
chr17 48972188 rs542435568 A G 4926654
chr17 48972230 rs531015822 T G 4926655
chr17 48972314 rs117278188 C A 4926656
chr17 48972360 rs376979327 C T 4926657
chr17 48972374 rs546985484 T C 4926658
chr17 48972547 rs16949441 C T 4926659
chr17 48972559 rs56259615 G A 4926660
chr17 48972574 rs182788262 T C 4926661
chr17 48972616 rs368718904 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926662
chr17 48972616 rs372291439 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926663
chr17 48972626 rs573838186 G A 4926664
chr17 48972647 rs542948445 C T 4926665
chr17 48972683 rs552994435 C T 4926666
chr17 48972813 rs149195468 G A 4926667
chr17 48972962 rs115569380 T G 4926668
chr17 48973014 rs574504754 A T 4926669
chr17 48973018 rs562846192 T C 4926670
chr17 48973032 rs12942588 A T 4926671
Genes possibly regulated by ZNF274[chr17:48971699-48973033]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:48971699-48973033]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results