EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:80448126-80450222]
Chromosome characteristics of TCF7L2[chr17:80448126-80450222]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:80448126-80450222]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80448407 80467804 enh4648
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on TCF7L2[chr17:80448126-80450222]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80448135 rs144106456 G T 5122146
chr17 80448200 rs115715025 G C 5122147
chr17 80448360 rs192344397 C T 5122148
chr17 80448474 rs9915939 G A 5122149
chr17 80448533 rs8081734 A G 5122150
chr17 80448612 rs369751588 T C 5122151
chr17 80448701 rs79936575 C T 5122152
chr17 80448777 rs188725345 T G 5122153
chr17 80448795 rs543532511 A G 5122154
chr17 80448837 rs537691531 C T 5122155
chr17 80448867 rs149084498 A G 5122156
chr17 80448873 rs9911081 C T 5122157
chr17 80448893 rs9900006 A T 5122158
chr17 80448895 rs78888245 G A 5122159
chr17 80448915 rs9894963 G A 5122160
chr17 80449016 rs9895201 G A 5122161
chr17 80449091 rs766360482 T TGAG 5122162
chr17 80449106 rs573417185 G C 5122163
chr17 80449139 rs9889575 C T 5122164
chr17 80449167 rs115347100 G C 5122165
chr17 80449188 rs146923295 C G 5122166
chr17 80449273 rs9895759 G T 5122167
chr17 80449332 rs9890044 C T 5122168
chr17 80449358 rs558282177 G A 5122169
chr17 80449424 rs143561938 C T 5122170
chr17 80449469 rs145849857 C T 5122171
chr17 80449502 rs184650306 G A 5122172
chr17 80449554 rs9896449 G T 5122173
chr17 80449568 rs73999962 G A 5122174
chr17 80449603 rs73999963 G A 5122175
chr17 80449625 rs563406868 C G 5122176
chr17 80449676 rs6502114 G A 5122177
chr17 80449697 rs1317685 C G,T 5122178
chr17 80449711 rs6502115 T A 5122179
chr17 80449735 rs180818168 C T 5122180
chr17 80449738 rs534323274 C T 5122181
chr17 80449750 rs186437952 C T 5122182
chr17 80449776 rs73999964 G A 5122183
chr17 80449784 rs6502116 A G,T 5122184
chr17 80449813 rs149612359 A G 5122185
chr17 80449815 rs112134118 A G 5122186
chr17 80449822 rs113661494 G A 5122187
chr17 80449828 rs144397505 G A 5122188
chr17 80449830 rs148785386 G T 5122189
chr17 80449854 rs74574088 T C 5122190
chr17 80450046 rs557061955 C T 5122191
chr17 80450137 rs9897468 C T 5122192
chr17 80450186 rs140605131 GGAGTGGTTAAAGTATAAAATA G 5122193
chr17 80450186 rs57902312 GGAGTGGTTAAAGTATAAAATA G 5122194
Genes possibly regulated by TCF7L2[chr17:80448126-80450222]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:80448126-80450222]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results