EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:80449531-80451615]
Chromosome characteristics of ZNF274[chr17:80449531-80451615]
Back to top
Enhancers possibly regulated by ZNF274[chr17:80449531-80451615]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80448407 80467804 enh4648
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Prostate (RWPE1) Lung Muscle (A673)
SNP sites on ZNF274[chr17:80449531-80451615]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80449554 rs9896449 G T 5122173
chr17 80449568 rs73999962 G A 5122174
chr17 80449603 rs73999963 G A 5122175
chr17 80449625 rs563406868 C G 5122176
chr17 80449676 rs6502114 G A 5122177
chr17 80449697 rs1317685 C G,T 5122178
chr17 80449711 rs6502115 T A 5122179
chr17 80449735 rs180818168 C T 5122180
chr17 80449738 rs534323274 C T 5122181
chr17 80449750 rs186437952 C T 5122182
chr17 80449776 rs73999964 G A 5122183
chr17 80449784 rs6502116 A G,T 5122184
chr17 80449813 rs149612359 A G 5122185
chr17 80449815 rs112134118 A G 5122186
chr17 80449822 rs113661494 G A 5122187
chr17 80449828 rs144397505 G A 5122188
chr17 80449830 rs148785386 G T 5122189
chr17 80449854 rs74574088 T C 5122190
chr17 80450046 rs557061955 C T 5122191
chr17 80450137 rs9897468 C T 5122192
chr17 80450186 rs140605131 GGAGTGGTTAAAGTATAAAATA G 5122193
chr17 80450186 rs57902312 GGAGTGGTTAAAGTATAAAATA G 5122194
chr17 80450230 rs144850455 CTTT C 5122195
chr17 80450230 rs542983597 CTTT C 5122196
chr17 80450230 rs754689668 CTTT C 5122197
chr17 80450379 rs59551429 C A,T 5122198
chr17 80450404 rs139489059 G A 5122199
chr17 80450445 rs183383601 T C 5122200
chr17 80450446 rs144343223 G A 5122201
chr17 80450459 rs532323636 T C 5122202
chr17 80450668 rs73999965 T C 5122203
chr17 80450680 rs149706772 G A,C 5122204
chr17 80450728 rs575563006 C T 5122205
chr17 80450746 rs77915519 A G 5122206
chr17 80450793 rs112707291 C T 5122207
chr17 80450870 rs112179511 C A,T 5122208
chr17 80450988 rs117483146 G A 5122209
chr17 80451211 rs376581351 A G 5122210
chr17 80451265 rs78260195 G A 5122211
chr17 80451298 rs548350707 C T 5122212
Genes possibly regulated by ZNF274[chr17:80449531-80451615]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:80449531-80451615]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results