EnhancerDB
  1. Home
  2. Gene
  3. ERAL1[ENSG00000132591.7]
Enhancers that regulate ERAL1[ENSG00000132591.7]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr17 27100910 27101180 vista24305 27181956 80776
VISTA
chr17 27104790 27105049 vista24306 27181956 76907
VISTA
chr17 27106105 27110255 enh104308 27181956 71701
Peripheral Blood (MM.1S)
chr17 27112558 27112737 vista24307 27181956 69219
VISTA
chr17 27116093 27116114 vista24308 27181956 65842
VISTA
chr17 27118425 27122607 enh69252 27181956 59349
Bone Marrow (K562) Neural Stem Cells (H9)
chr17 27118575 27118718 vista24309 27181956 63238
VISTA
chr17 27125345 27129495 enh4314 27181956 52461
Blood (Karpas-422)
chr17 27129097 27129445 vista24310 27181956 52511
VISTA
chr17 27132321 27138735 enh4315 27181956 43221
Bone Marrow (K562) Liver Astrocyte Blood (Karpas-422) Pancreas Uterus Stomach Epithelial (MCF-7) Skin (Keratinocyte) Bone (Osteoblast) Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr17 27138672 27138846 vista24311 27181956 43110
VISTA
chr17 27144825 27148975 enh4316 27181956 32981
Blood (Karpas-422)
chr17 27153714 27158004 enh102562 27181956 23952
Bone (Osteoblast)
chr17 27164285 27175528 enh75885 27181956 6428
Muscle (A673) Prostate (RWPE1)
chr17 27189702 27189769 vista24312 27181956 7746
VISTA
chr17 27190245 27194555 enh52454 27181956 8289
Bone Marrow (K562) Large Intestine Stomach
chr17 27192241 27192644 vista24313 27181956 10285
VISTA
chr17 27196285 27201995 enh48014 27181956 14329
Bone Marrow (K562) Peripheral Blood (MM.1S) Thymus Blood (T-cell)
chr17 27199839 27200032 vista24314 27181956 17883
VISTA
chr17 27212385 27223219 enh4317 27181956 30429
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Stomach
chr17 27220048 27220212 vista24315 27181956 38092
VISTA
chr17 27255195 27255444 vista24316 27181956 73239
VISTA
chr17 27261256 27270035 enh4318 27181956 79300
Prostate (PC-3) Liver (HepG2) Esophagus Liver Stomach Muscle (A673) Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Pancreas Neural Stem Cells (H9) Heart
chr17 27264479 27264617 vista24317 27181956 82523
VISTA
chr17 27271313 27275575 enh102563 27181956 89357
Bone (Osteoblast)
chr17 27273335 27273648 vista24318 27181956 91379
VISTA
Transcript facotrs that regulate ERAL1[ENSG00000132591.7]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with ERAL1[ENSG00000132591.7], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr17 28002642 rs71371126 G A 814557 Esophagus 0.132441 4817687
chr17 28032347 rs9303626 G C 844262 Esophagus 0.380051 4817915
chr17 28148571 rs78890224 T C 960486 Pancreas 0.246431 4818771
chr17 27570029 rs55918020 GTCAT G 381944 Uterus 0.169834 4815944
chr17 27673530 rs569687207 GCCATGTTGGCCAGGCTGGTCTCACCTGGCCAGGCTGGTCTGA G 485445 Lung 0.256352 4816335
chr17 26190601 rs118112912 G A 991355 Adrenal 0.152842 4809808
Details of ERAL1[ENSG00000132591.7]
Back to top
Genomic Location chr17:27181956-27188085[+]
TSS 27181956
Gene Name ERAL1
Ensembl ID ENSG00000132591.7
ENTREZID 26284
Uniprot
O75616
Protein Name
mitochondrial
GTPase Era
Expression levels of ERAL1[ENSG00000132591.7]
Back to top