EnhancerDB
  1. Home
  2. Gene
  3. G6PC3[ENSG00000141349.4]
Enhancers that regulate G6PC3[ENSG00000141349.4]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr17 42045905 42054795 enh92728 42148103 93308
Liver (HepG2) Brain (SK-N-SH)
chr17 42061095 42061375 vista24863 42148103 86728
VISTA
chr17 42061665 42066236 enh44431 42148103 81867
Muscle (Myotube) Peripheral Blood (MM.1S)
chr17 42070385 42079775 enh17178 42148103 68328
Thyroid Placenta Large Intestine
chr17 42100535 42100831 vista24864 42148103 47272
VISTA
chr17 42101631 42102033 vista24865 42148103 46070
VISTA
chr17 42115729 42123816 enh32201 42148103 24287
Prostate (PC-3) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Muscle (A673)
chr17 42124945 42132655 enh44432 42148103 15448
Muscle (Myoblast) Muscle (Myotube) Heart
chr17 42158025 42162175 enh110894 42148103 9922
Cervix (HeLa-S3)
chr17 42170662 42193575 enh17179 42148103 22559
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr17 42173050 42173151 vista24866 42148103 24947
VISTA
chr17 42173326 42173627 vista24867 42148103 25223
VISTA
chr17 42174643 42174888 vista24868 42148103 26540
VISTA
chr17 42198947 42199210 vista24869 42148103 50844
VISTA
chr17 42203885 42213635 enh17180 42148103 55782
Bone Marrow (K562) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Epithelial (MCF-7)
chr17 42215472 42215904 vista24870 42148103 67369
VISTA
chr17 42234945 42239095 enh91158 42148103 86842
Bone Marrow (K562)
chr17 42245888 42246083 vista24871 42148103 97785
VISTA
Transcript facotrs that regulate G6PC3[ENSG00000141349.4]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with G6PC3[ENSG00000141349.4], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr17 42127570 rs2245541 C T 20533 Esophagus 6.4081e-06 4887703
chr17 42116721 rs75464856 C A 31382 Pancreas 0.360871 4887588
chr17 42125228 rs228756 A G 22875 Breast 0.0025444 4887668
chr17 42325043 rs577828071 CTGGCAGAGTTAGCTCTCTGACCCTT C 171334 Spleen 0.122103 4888816
chr17 41663275 rs141754841 G C 484828 Uterus 0.425071 4884474
chr17 42148205 rs228758 C G,T 0 Lung 0.000691134 4887797
Details of G6PC3[ENSG00000141349.4]
Back to top
Genomic Location chr17:42148103-42153709[+]
TSS 42148103
Gene Name G6PC3
Ensembl ID ENSG00000141349.4
ENTREZID 92579
Uniprot
Q9BUM1
Protein Name
Glucose-6-phosphatase 3
Expression levels of G6PC3[ENSG00000141349.4]
Back to top