EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:8196493-8199056]
Chromosome characteristics of ZNF274[chr1:8196493-8199056]
Back to top
Enhancers possibly regulated by ZNF274[chr1:8196493-8199056]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 8164245 8205415 enh11462
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Lung (A549) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
chr1 8198088 8198334 vista230
VISTA
SNP sites on ZNF274[chr1:8196493-8199056]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 8196599 rs9435016 C T 51994
chr1 8196659 rs139998079 C T 51995
chr1 8196660 rs371091899 G A 51996
chr1 8196679 rs555731688 T C 51997
chr1 8196994 rs78245003 G A 51998
chr1 8197006 rs12086021 G A 51999
chr1 8197153 rs377443236 A G 52000
chr1 8197208 rs140916196 G A 52001
chr1 8197219 rs150224534 C T 52002
chr1 8197313 rs147910152 A T 52003
chr1 8197347 rs141631342 G A 52004
chr1 8197408 rs112163664 G A 52005
chr1 8197415 rs542049289 G A 52006
chr1 8197455 rs138473599 C G 52007
chr1 8197477 rs6667345 C T 52008
chr1 8197516 rs143372766 T C 52009
chr1 8197582 rs17032209 A G 52010
chr1 8197725 rs150977172 AG A 52011
chr1 8197981 rs111876640 T C 52012
chr1 8198044 rs190889282 C A,G,T 52013
chr1 8198105 rs78767192 G T 52014
chr1 8198155 rs7546806 G T 52015
chr1 8198175 rs139245285 G C 52016
chr1 8198289 rs530587032 G A 52017
chr1 8198309 rs7546936 G A 52018
chr1 8198367 rs536756637 CAGCTGTCCTCAGGTTGCCGGTCCAT C 52019
chr1 8198379 rs568377057 G A 52020
chr1 8198385 rs9434616 C T 52021
chr1 8198386 rs368664848 G A 52022
chr1 8198414 rs79474574 A C 52023
chr1 8198427 rs113418767 A C 52024
chr1 8198430 rs187042106 C T 52025
chr1 8198635 rs115310246 C T 52026
chr1 8198722 rs7537158 A G 52027
chr1 8199015 rs190070983 C T 52028
Genes possibly regulated by ZNF274[chr1:8196493-8199056]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:8196493-8199056]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results