EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr15:101732720-101734106]
Chromosome characteristics of ZNF274[chr15:101732720-101734106]
Back to top
Enhancers possibly regulated by ZNF274[chr15:101732720-101734106]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 101726845 101770455 enh16480
Liver Astrocyte Colon (HCT116) Adrenal Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr15 101733484 101734132 vista21468
VISTA
SNP sites on ZNF274[chr15:101732720-101734106]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 101732820 rs61431916 CAA C 4239232
chr15 101732820 rs796259812 CAA C 4239233
chr15 101732840 rs185199506 T G 4239234
chr15 101732862 rs11247274 C T 4239235
chr15 101732902 rs141048926 T TCTCACAGATTCTTTCCACA 4239236
chr15 101732921 rs188500354 G A 4239237
chr15 101732931 rs329290 G A 4239238
chr15 101732979 rs117500665 T G 4239239
chr15 101733079 rs8036374 T A,C 4239240
chr15 101733082 rs56220789 G A 4239241
chr15 101733114 rs8036393 T A,G 4239242
chr15 101733221 rs181453648 C T 4239243
chr15 101733273 rs77325794 G A 4239244
chr15 101733365 rs562552293 GCT G 4239245
chr15 101733410 rs4965805 T C 4239246
chr15 101733422 rs112726906 G A 4239247
chr15 101733471 rs56259363 C T 4239248
chr15 101733490 rs329291 G T 4239249
chr15 101733616 rs561411784 C A 4239250
chr15 101733691 rs139302887 G A 4239251
chr15 101733732 rs547048267 C A 4239252
chr15 101733734 rs76049476 C T 4239253
chr15 101733808 rs145555188 C T 4239254
chr15 101734080 rs2012387 C T 4239255
chr15 101734095 rs111330820 T C 4239256
Genes possibly regulated by ZNF274[chr15:101732720-101734106]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr15:101732720-101734106]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results