-
Home
- TFBS
- ZZZ3[chr17:28049558-28050122]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr17 |
28029886 |
28064015 |
enh4330 |
|
|
| chr17 |
28049478 |
28050072 |
vista24357 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr17
|
28049590
|
rs116018379
|
C
|
G
|
4818053
|
|
|
chr17
|
28049804
|
rs2617865
|
G
|
T
|
4818054
|
|
|
chr17
|
28050121
|
rs533409366
|
TGCAAGATATCCCATCTCTGTGG
|
T
|
4818055
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |