EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:80829220-80829858]
Chromosome characteristics of TCF7L2[chr17:80829220-80829858]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:80829220-80829858]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 80814305 80837217 enh17458
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Bone (Osteoblast) Blood (GM12878) Stomach Placenta Colon (HCT116) Breast Uterus Thyroid Pancreas Neural Stem Cells (H9) Heart
chr17 80829054 80829460 vista26487
VISTA
SNP sites on TCF7L2[chr17:80829220-80829858]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 80829253 rs56264327 C T 5125644
chr17 80829288 rs8065975 C G,T 5125645
chr17 80829293 rs532797438 T C 5125646
chr17 80829328 rs183642003 T C 5125647
chr17 80829544 rs115633912 C T 5125648
chr17 80829545 rs567388817 G A 5125649
chr17 80829707 rs7209562 C T 5125650
chr17 80829716 rs555927554 T C 5125651
chr17 80829773 rs574158867 C G 5125652
chr17 80829783 rs534893728 CAAGCAGCTCGTTGTGAGGCACACGCTGGT C 5125653
chr17 80829807 rs9900369 G A 5125654
chr17 80829817 rs145896890 A C,G 5125655
chr17 80829850 rs563305146 C T 5125656
Genes possibly regulated by TCF7L2[chr17:80829220-80829858]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:80829220-80829858]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results