EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:2626048-2629160]
Chromosome characteristics of ZNF274[chr19:2626048-2629160]
Back to top
Enhancers possibly regulated by ZNF274[chr19:2626048-2629160]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2605719 2641695 enh4960
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Stomach Skin (Keratinocyte) Ovary Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
chr19 2627461 2627884 vista28244
VISTA
chr19 2627989 2628256 vista28245
VISTA
SNP sites on ZNF274[chr19:2626048-2629160]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2626078 rs150212685 G A,T 5387216
chr19 2626081 rs112173850 C T 5387217
chr19 2626194 rs140630470 G A 5387218
chr19 2626211 rs542363346 G A 5387219
chr19 2626248 rs371823692 G A,C 5387220
chr19 2626296 rs554437006 C T 5387221
chr19 2626467 rs13346057 C T 5387222
chr19 2626615 rs368627780 G A 5387223
chr19 2626698 rs138256725 G A 5387224
chr19 2626726 rs76623902 G A 5387225
chr19 2626761 rs116462104 G A 5387226
chr19 2627008 rs57807819 C T 5387227
chr19 2627019 rs143185534 C T 5387228
chr19 2627023 rs7254152 A G 5387229
chr19 2627058 rs148238409 T C 5387230
chr19 2627098 rs141266800 G T 5387231
chr19 2627123 rs150780524 G A 5387232
chr19 2627164 rs549676329 G C 5387233
chr19 2627441 rs554410870 G A 5387234
chr19 2627519 rs147138137 C T 5387235
chr19 2627524 rs111479860 A G 5387236
chr19 2627561 rs74631976 C T 5387237
chr19 2627585 rs140308402 C T 5387238
chr19 2627635 rs12462730 C T 5387239
chr19 2628017 rs145419131 A G 5387240
chr19 2628046 rs6510691 A C 5387241
chr19 2628110 rs111586271 G A 5387242
chr19 2628196 rs181610197 G T 5387243
chr19 2628218 rs541796946 G A 5387244
chr19 2628309 rs73528632 C G 5387245
chr19 2628439 rs148761965 C T 5387246
chr19 2628473 rs142397220 A G 5387247
chr19 2628506 rs113456900 G GGT 5387248
chr19 2628506 rs368627628 GGT G 5387249
chr19 2628506 rs532250879 G GGT,GGTGT 5387250
chr19 2628525 rs62123740 A G 5387251
chr19 2628527 rs151308025 A G 5387252
chr19 2628546 rs140609641 C T 5387253
chr19 2628577 rs372817908 T C 5387254
chr19 2628614 rs554872213 G GGCTCTCCAGAACCTTCCATCTTGTAAAACTGAGACACTGTACA 5387255
chr19 2628749 rs144302555 C T 5387256
chr19 2628812 rs114851593 A G 5387257
chr19 2628832 rs146532856 T C 5387258
chr19 2628836 rs113494085 A G 5387259
chr19 2628867 rs150157113 C T 5387260
chr19 2628880 rs148910157 T C 5387261
chr19 2628888 rs143549085 T C 5387262
chr19 2628945 rs60177277 G A 5387263
chr19 2628978 rs56812321 C G,T 5387264
chr19 2629033 rs77158403 G T 5387265
chr19 2629151 rs190788819 C T 5387266
Genes possibly regulated by ZNF274[chr19:2626048-2629160]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:2626048-2629160]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results