Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 151897843 rs576872800 A G 627873
chr1 151898037 rs3007685 T G 627874
chr1 151898374 rs180834851 T C 627875
chr1 151898453 rs34457813 AT A 627876
chr1 151898458 rs112385496 T A 627877
chr1 151898460 rs565776790 T A 627878
chr1 151898513 rs145297864 G C 627879
chr1 151898542 rs113815405 C CAGGT 627880
chr1 151898542 rs569729047 C CAGGT 627881
chr1 151898599 rs113001874 G A 627882
chr1 151898659 rs111922151 T G 627883
chr1 151898749 rs2999541 G C 627884
chr1 151898829 rs142150117 C T 627885
chr1 151898843 rs56078223 T G 627886
chr1 151898876 rs182477998 C G 627887
chr1 151898884 rs142924977 C CCCAAGGGGGTTTTATTGGCT 627888

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results