EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85239278-85240667]
Chromosome characteristics of ZNF274[chr16:85239278-85240667]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85239278-85240667]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85219145 85290912 enh16864
Bone Marrow (K562) Astrocyte Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr16:85239278-85240667]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85239385 rs35205163 T G 4618446
chr16 85239394 rs117890091 A G 4618447
chr16 85239504 rs115830618 C T 4618448
chr16 85239529 rs187658216 G A 4618449
chr16 85239587 rs116264363 G C 4618450
chr16 85239626 rs78052138 C T 4618451
chr16 85239764 rs558693465 C T 4618452
chr16 85239767 rs147552048 G A 4618453
chr16 85239777 rs76151007 G A,C,T 4618454
chr16 85239797 rs141538436 T TG 4618455
chr16 85239797 rs561292369 T TG 4618456
chr16 85239797 rs565223799 TG T 4618457
chr16 85239806 rs118138567 C T 4618458
chr16 85239807 rs187443713 G A,C 4618459
chr16 85239824 rs148612617 C T 4618460
chr16 85239825 rs116845317 G A,C 4618461
chr16 85239827 rs370116295 G T 4618462
chr16 85239884 rs117320193 G A 4618463
chr16 85239958 rs534406458 C T 4618464
chr16 85239959 rs142099953 G A 4618465
chr16 85239962 rs71386902 C T 4618466
chr16 85239995 rs71389103 G T 4618467
chr16 85240289 rs572074064 G A 4618468
chr16 85240370 rs569777105 GCCGCCAGGATGGAGGTGCTGGCCCC G 4618469
chr16 85240548 rs543985810 G A 4618470
chr16 85240593 rs564019415 G A 4618471
chr16 85240597 rs532835425 C T 4618472
chr16 85240598 rs62050672 G A 4618473
Genes possibly regulated by ZNF274[chr16:85239278-85240667]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85239278-85240667]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results