EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85240036-85241490]
Chromosome characteristics of TCF7L2[chr16:85240036-85241490]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85240036-85241490]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85219145 85290912 enh16864
Bone Marrow (K562) Astrocyte Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on TCF7L2[chr16:85240036-85241490]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85240289 rs572074064 G A 4618468
chr16 85240370 rs569777105 GCCGCCAGGATGGAGGTGCTGGCCCC G 4618469
chr16 85240548 rs543985810 G A 4618470
chr16 85240593 rs564019415 G A 4618471
chr16 85240597 rs532835425 C T 4618472
chr16 85240598 rs62050672 G A 4618473
chr16 85240701 rs375608045 C T 4618474
chr16 85240793 rs374826898 A AC 4618475
chr16 85240800 rs192080088 C A,T 4618476
chr16 85240813 rs536891641 G T 4618477
chr16 85240821 rs189423309 C T 4618478
chr16 85240842 rs79178185 C G 4618479
chr16 85240935 rs534974470 C G,T 4618480
chr16 85240959 rs183778120 G A 4618481
chr16 85240971 rs563858050 C T 4618482
chr16 85241085 rs562522030 G A,T 4618483
chr16 85241108 rs561680425 G A 4618484
chr16 85241165 rs111744350 A ATCTAC,ATCTTC 4618485
chr16 85241165 rs61004668 A ATCTTC 4618486
chr16 85241278 rs62050673 C T 4618487
chr16 85241282 rs55818488 G T 4618488
chr16 85241367 rs7203362 G A 4618489
chr16 85241418 rs141070708 C T 4618490
Genes possibly regulated by TCF7L2[chr16:85240036-85241490]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85240036-85241490]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results