EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85274348-85278275]
Chromosome characteristics of TCF7L2[chr16:85274348-85278275]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85274348-85278275]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85219145 85290912 enh16864
Bone Marrow (K562) Astrocyte Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on TCF7L2[chr16:85274348-85278275]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85274398 rs138273376 T C,G 4619133
chr16 85274414 rs149629714 G T 4619134
chr16 85274439 rs144398615 A G 4619135
chr16 85274453 rs148185704 A G 4619136
chr16 85274478 rs556144641 C T 4619137
chr16 85274515 rs572276751 AG A 4619138
chr16 85274534 rs141558714 C G 4619139
chr16 85274586 rs563115416 C G 4619140
chr16 85274688 rs527941904 C T 4619141
chr16 85274689 rs28612891 G A 4619142
chr16 85274780 rs564979188 TGACCTTGGGCTCGGCTGCGA T 4619143
chr16 85274800 rs28467482 A T 4619144
chr16 85274867 rs117628616 G A 4619145
chr16 85274900 rs74031739 G A 4619146
chr16 85274978 rs528014661 G T 4619147
chr16 85275027 rs192872688 T G 4619148
chr16 85275040 rs144045105 T A 4619149
chr16 85275075 rs554576059 G A,T 4619150
chr16 85275091 rs118012436 G A 4619151
chr16 85275105 rs35268317 G T 4619152
chr16 85275187 rs146634255 C CT 4619153
chr16 85275198 rs565528147 C G 4619154
chr16 85275227 rs150552174 G A 4619155
chr16 85275256 rs74031740 G A 4619156
chr16 85275266 rs551845595 T C 4619157
chr16 85275282 rs74031741 A G 4619158
chr16 85275299 rs568277275 C A,T 4619159
chr16 85275351 rs139578513 G A 4619160
chr16 85275438 rs147411871 C A,G,T 4619161
chr16 85275457 rs4592642 C T 4619162
chr16 85275469 rs541289209 C T 4619163
chr16 85275478 rs142334313 C T 4619164
chr16 85275498 rs192368467 T G 4619165
chr16 85275554 rs144660440 C G 4619166
chr16 85275615 rs545345468 C T 4619167
chr16 85275686 rs147902534 C T 4619168
chr16 85275772 rs117731881 G A 4619169
chr16 85275783 rs141600605 C T 4619170
chr16 85275818 rs147064498 C A 4619171
chr16 85275833 rs115005116 G A 4619172
chr16 85275835 rs7498262 T C 4619173
chr16 85275863 rs75373763 C A,G,T 4619174
chr16 85275894 rs11643980 T G 4619175
chr16 85275932 rs151080345 G A 4619176
chr16 85276001 rs141054672 T C 4619177
chr16 85276133 rs9930184 T C 4619178
chr16 85276142 rs34322624 C T 4619179
chr16 85276143 rs372261590 G A 4619180
chr16 85276274 rs188161114 G A 4619181
chr16 85276294 rs35561582 T A 4619182
chr16 85276317 rs181468891 G A 4619183
chr16 85276346 rs74031742 G A 4619184
chr16 85276377 rs190367971 A C,G 4619185
chr16 85276423 rs141517503 A T 4619186
chr16 85276427 rs34652348 T A 4619187
chr16 85276511 rs8048971 G A,C 4619188
chr16 85276638 rs181688409 C T 4619189
chr16 85276639 rs561826594 G C,T 4619190
chr16 85276697 rs533293531 G A 4619191
chr16 85276800 rs528488740 A G 4619192
chr16 85276889 rs143964976 C T 4619193
chr16 85276963 rs148658999 G A 4619194
chr16 85276979 rs186441252 G A 4619195
chr16 85276989 rs36021707 GC G 4619196
chr16 85276991 rs57492763 T G 4619197
chr16 85277002 rs555367657 G A 4619198
chr16 85277078 rs141280248 C T 4619199
chr16 85277105 rs150795717 G T 4619200
chr16 85277111 rs117160231 G A 4619201
chr16 85277187 rs550650895 G T 4619202
chr16 85277334 rs12924184 G A 4619203
chr16 85277374 rs34772519 A G 4619204
chr16 85277471 rs183093914 G A 4619205
chr16 85277480 rs185136974 C G,T 4619206
chr16 85277498 rs190697964 C G 4619207
chr16 85277625 rs530821373 A T 4619208
chr16 85277674 rs183404822 G A,T 4619209
chr16 85277679 rs564264355 C A,T 4619210
chr16 85277680 rs139814946 G A 4619211
chr16 85277683 rs111837029 G C 4619212
chr16 85277873 rs11860572 C G 4619213
chr16 85278075 rs556040753 A T 4619214
chr16 85278211 rs147865795 G A,T 4619215
Genes possibly regulated by TCF7L2[chr16:85274348-85278275]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85274348-85278275]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results