EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85648050-85650153]
Chromosome characteristics of ZNF274[chr16:85648050-85650153]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85648050-85650153]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85640485 85664563 enh16874
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Liver Stomach Muscle (A673) Placenta Embryonic Stem Cell Line (H1-hESC) Pancreas Muscle (Myotube) Uterus Blood (T-cell) Heart
chr16 85648720 85648939 vista23334
VISTA
SNP sites on ZNF274[chr16:85648050-85650153]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85648097 rs140240552 G A 4626343
chr16 85648119 rs533768188 C T 4626344
chr16 85648176 rs149524016 GC G 4626345
chr16 85648176 rs562341579 GC G 4626346
chr16 85648196 rs570960401 C CG 4626347
chr16 85648430 rs566515424 CA C 4626348
chr16 85648497 rs560653674 C G 4626349
chr16 85648580 rs192150377 G A 4626350
chr16 85648617 rs80266873 C T 4626351
chr16 85648708 rs189793596 C T 4626352
chr16 85648817 rs540245048 A G 4626353
chr16 85648844 rs560930493 C T 4626354
chr16 85648870 rs137882357 C T 4626355
chr16 85648892 rs551989019 C T 4626356
chr16 85649008 rs577800717 TCTC T 4626357
chr16 85649086 rs573802476 GCTGGAGCCAACCACGGTTTTGACGCTTGGAGTTTTCTTTC G 4626358
chr16 85649256 rs534261071 C T 4626359
chr16 85649322 rs542636277 T C 4626360
chr16 85649390 rs150110233 C T 4626361
chr16 85649482 rs116187584 G A,C 4626362
chr16 85649505 rs529719021 G T 4626363
chr16 85649579 rs138606076 C G,T 4626364
chr16 85649647 rs72801183 T C,G 4626365
chr16 85649690 rs536667245 C T 4626366
chr16 85649880 rs529717958 C G,T 4626367
chr16 85649987 rs75455611 A G 4626368
chr16 85650073 rs139715816 C T 4626369
Genes possibly regulated by ZNF274[chr16:85648050-85650153]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85648050-85650153]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results