Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 28049590 rs116018379 C G 4818053
chr17 28049804 rs2617865 G T 4818054
chr17 28050121 rs533409366 TGCAAGATATCCCATCTCTGTGG T 4818055

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results