EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:57430101-57434473]
Chromosome characteristics of ZNF143[chr17:57430101-57434473]
Back to top
Enhancers possibly regulated by ZNF143[chr17:57430101-57434473]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 57421845 57430335 enh17257
Liver (HepG2) Esophagus Thyroid Placenta Lung (PC-9) Epithelial (MCF-7)
chr17 57433402 57461748 enh17258
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Lung Muscle (A673) Heart
chr17 57434419 57434635 vista25321
VISTA
SNP sites on ZNF143[chr17:57430101-57434473]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 57430708 rs148048460 G A 4959151
chr17 57430915 rs561014717 C T 4959152
chr17 57431029 rs187675194 C A 4959153
chr17 57431156 rs555713052 G A 4959154
chr17 57431157 rs574078723 G A 4959155
chr17 57431259 rs112352249 A T 4959156
chr17 57431398 rs150846196 C T 4959157
chr17 57431408 rs10853010 C T 4959158
chr17 57431437 rs375758953 G C 4959159
chr17 57431469 rs528292386 C T 4959160
chr17 57431648 rs12936336 G C 4959161
chr17 57431714 rs149561198 G A 4959162
chr17 57431732 rs371157951 T TAA 4959163
chr17 57431732 rs569957639 T TA,TAA 4959164
chr17 57431759 rs73996405 G A 4959165
chr17 57431766 rs9903669 G C 4959166
chr17 57431902 rs114946949 T C 4959167
chr17 57431929 rs140165201 G A 4959168
chr17 57432009 rs117699449 C A,T 4959169
chr17 57432090 rs111459494 C T 4959170
chr17 57432133 rs191895955 T G 4959171
chr17 57432308 rs78511639 T C 4959172
chr17 57432324 rs113813449 G A 4959173
chr17 57432330 rs60242681 C CT,CTT 4959174
chr17 57432343 rs60516086 C T 4959175
chr17 57432363 rs182372436 A G 4959176
chr17 57432440 rs528659359 A G,T 4959177
chr17 57432862 rs557799719 C CAAGCCACATCGCCTGAATA 4959178
chr17 57433011 rs151168721 T C 4959179
chr17 57433026 rs140097832 G A 4959180
chr17 57433111 rs147464693 G GA 4959181
chr17 57433112 rs184336457 A G 4959182
chr17 57433136 rs58299620 A G 4959183
chr17 57433428 rs536229600 G A 4959184
chr17 57433474 rs189158875 G A 4959185
chr17 57433513 rs534141240 T C 4959186
chr17 57433656 rs147645130 G A 4959187
chr17 57433664 rs35471671 C CA 4959188
chr17 57433664 rs397711161 C CA 4959189
chr17 57433706 rs116533609 G A,C 4959190
chr17 57433747 rs35909196 A AG 4959191
chr17 57433747 rs397704142 A AG 4959192
chr17 57434101 rs571950622 T G 4959193
chr17 57434209 rs534853026 CT C 4959194
chr17 57434212 rs565593827 T A 4959195
chr17 57434214 rs555079254 TA T 4959196
chr17 57434216 rs532725075 A G 4959197
chr17 57434309 rs60163728 G A 4959198
chr17 57434316 rs4968354 T C 4959199
chr17 57434319 rs112542395 A G 4959200
Genes possibly regulated by ZNF143[chr17:57430101-57434473]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:57430101-57434473]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results