EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr17:79546234-79547121]
Chromosome characteristics of TCF7L2[chr17:79546234-79547121]
Back to top
Enhancers possibly regulated by TCF7L2[chr17:79546234-79547121]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79539405 79553215 enh32380
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Muscle (Myoblast) Pancreas Pancreas (Panc1) Uterus Epithelial (MCF-7)
chr17 79546845 79547000 vista26423
VISTA
SNP sites on TCF7L2[chr17:79546234-79547121]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79546545 rs72855663 C G 5115136
chr17 79546573 rs143813960 G A 5115137
chr17 79546689 rs75932482 C T 5115138
chr17 79546709 rs62073414 C G 5115139
chr17 79546764 rs75271791 A C 5115140
chr17 79546850 rs4078371 G T 5115141
chr17 79546856 rs571327903 G A 5115142
chr17 79546888 rs545627936 ATGTGAGCTCACCCCCCATTCTCCTC A 5115143
chr17 79546924 rs556743021 C A,T 5115144
chr17 79546925 rs192608548 C T 5115145
chr17 79547015 rs573558799 G A 5115146
chr17 79547019 rs540892004 G A 5115147
chr17 79547037 rs79973778 A T 5115148
chr17 79547105 rs530259678 C G 5115149
chr17 79547114 rs62073415 A G 5115150
Genes possibly regulated by TCF7L2[chr17:79546234-79547121]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr17:79546234-79547121]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results